Labshake search
Citations for Lucigen :
1001 - 1050 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... and the MasterPureTM Yeast RNA Purification Kit (Epicentre). cDNAs were synthesized with the FastQuant RT Kit (with gDNase ...
-
bioRxiv - Genomics 2022Quote: ... Subsequent library preparation was performed with the NxSeq® AmpFREE Low DNA Library Kit (Lucigen®; Cat. no. 14000-1) according to the manufacturer’s instructions with one slight modification ...
-
bioRxiv - Genomics 2022Quote: ... the clean-up DNAs underwent the protocol SYGNIS TruePrimeTM WGA & Single Cell WGA Kits (Lucigen), instead of the REPLI-g single cell kit ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted using the MasterPure kit (Lucigen, cat no MC85200).
-
bioRxiv - Genetics 2022Quote: ... The ligated product was then electroporated into Enduratm electro-competent cells (Lucigen #60242-1) in 2 separate reactions ...
-
bioRxiv - Genetics 2022Quote: ... Endura Electrocompetent cells from Lucigen; Mighty Mix T4 DNA ligase from Takara ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (Lucigen). To allow for fluorescent labeling of Wsp1p-PRD ...
-
bioRxiv - Neuroscience 2022Quote: Monophosphorylated RNAs were selectively degraded by Terminator 5’-phosphate-dependent exonuclease (Lucigen). Subsequent 5’ dephosphorylation by quickCIP (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... The homology arms were amplified from extracted HEK-293 cell genomic DNA (QuickExtract DNA extraction solution, Lucigen). The fidelity of all constructs was confirmed by Sanger sequencing prior to use.
-
bioRxiv - Biochemistry 2022Quote: ... coli C43(DE3) (Lucigen). E ...
-
bioRxiv - Biochemistry 2022Quote: ... Cloni 10G electrocompentent cells (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified using MasterPure Yeast DNA purification Kit (Epicentre) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... The ScriptSeq™ v2 RNA-Seq Library Preparation Kit (Epicentre) was used to make the libraries according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Offspring genotypes were confirmed by PCR (Lucigen EconoTaq Plus GREEN 2X) and both heterozygous and homozygous ChAT-cre/jRGECO1a mice were used in the experiments and no phenotypic difference were observed.
-
bioRxiv - Immunology 2022Quote: ... Cell pellets were lysed using QuickExtract DNA Extraction Solution (Lucigen) following supplier’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... ribosomal RNA was removed by Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre) and rRNA-free residue was obtained by ethanol precipitation ...
-
bioRxiv - Biophysics 2022Quote: ... Coli (Lucigen, Middleton, WI). Terrific Broth (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... The WT NPSL2 DNA template was amplified via polymerase chain reaction (PCR) using a set of four primers (Table S4) with EconoTaq PLUS 2x Master Mix (Lucigen). All the primers were ordered from Integrated DNA Technologies ...
-
bioRxiv - Biophysics 2022Quote: ... DNA from these cells was extracted using QuickExtract DNA extraction solution (Lucigen # QE09050) and used as a template for confirmation of homologous recombination by PCR and Sanger sequencing.
-
bioRxiv - Bioengineering 2022Quote: ... the purified RNAs were digested by RNase R exoribonuclease (Lucigen, RNR07520) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: DNA was extracted from harvested cells using the QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Bioengineering 2022Quote: ... The first passage after electroporation genomic DNA was isolated using QuickExtract™ (Lucigen), following manufacturer protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... at 37°C (1 – 2 h) and 0.9 μl from the reaction mix were electroporated to E.coli Cloni® 10G cells (Lucigen, USA). Colony PCR and sequencing were used for analysis and verification.
-
bioRxiv - Synthetic Biology 2022Quote: ... two ncRNA expression cassettes (for barcoded ncRNAs “A” and “B”) from the Marionette plasmids were cloned into pSol-TSF (Lucigen F843213-1) facing in opposite directions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... this mixture was mixed with the components of AmpliScribe™ T7-Flash™ Transcription Kit (Lucigen, USA) and incubated for eight hours at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... a C-terminal AviTag was added to the pSANG10 expression constructs (pSANG10-Avi) and scFvs transformed into BL21[DE3] cells (Lucigen) containing the pBirAcm plasmid (Avidity).
-
bioRxiv - Microbiology 2022Quote: ... The sample suspension was digested with 1 μL Ready-Lyse lysozyme (1000 U/ μL, Epicentre), and 3 μL proteinase K (20 mg/mL ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2459 bp) were in vitro transcribed using Ampliscribe™ T7-Flash™ Transcription Kit (Lucigen-ASF3507). Curlcake 2 was polyadenylated using E ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from cells using the QuickExtract DNA Extraction Solution (Lucigen) and sequencing was performed with 110x coverage using 100 base pair paired end read lengths ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 ng of library was added to 25 µL of Endura electrocompetent cells (Lucigen). Cells were electroporated using the MicroPulser (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... Single cells were FACS sorted into 1 ul each of QuickExtract DNA Extraction Buffer (Lucigen). DNA was extracted by incubating cells for 10 minutes at 65°C followed by 5 minutes at 98°C ...
-
bioRxiv - Genomics 2022Quote: ... coli strain (Lucigen, EC300150). E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Endura electrocompetent cells (Lucigen, Cat. No. 60242) were used to perform six electroporation reactions on a MicroPulserTM II (BioRad ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Lucigen). FLO11 was amplified with Phusion polymerase (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... Genome DNA was extracted from survival cells using QuickExtract DNA Solution 1.0 (Epicentre), and amplified PCR products using primers listed in Table S1 were sub-cloned into pGEM-T Easy (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were re-suspended in 20 μl of DNA Extraction Solution (Lucigen), and incubated at 68°C for 6 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fig 5B-D and Fig EV5 were obtained as follows: Total RNA was extracted from cells using the MasterPure Yeast RNA Purification Kit including a DNase treatment step (Epicentre), and converted to cDNA using random primers and the RevertAid Reverse Transcriptase kit (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted from 1.5 mL of logarithmically growing cells (OD600 ~0.6-0.8) using the Masterpure Yeast RNA Purification kit (Epicentre). Residual genomic DNA was removed using the Turbo DNA-free kit (Ambion) ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 1 1l genomic DNA in QuickExtract DNA Extraction Solution (Lucigen). After droplet generation with the QX200 Droplet generator (Biorad) ...
-
bioRxiv - Neuroscience 2022Quote: ... The puck was immersed in 200 µL of hybridization buffer (6X SSC, 2 unit / µL Lucigen NxGen RNAse inhibitor) for 30 minutes at 37°C for the binding of RNA to the oligos ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping was achieved by polymerase chain reaction with EconoTaq® DNA polymerase (Lucigen). Primers for genotyping of CEP164 mice ...
-
bioRxiv - Neuroscience 2022Quote: ... ChIP DNA was end-repaired (End-it DNA Repair kit; Epicentre) and A-tailed (Klenow Exo-minus ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genomic DNA of cells was extracted using QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... cloni 10G competent cells (Lucigen). Protein expression was performed as described (45) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1× transcription buffer (Epicentre Technologies), 125 μCi of 35S-labeled UTP ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...