Labshake search
Citations for Lucigen :
851 - 900 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from concentrated cells using the MasterPure complete DNA and RNA purification kit (Epicentre) and sequenced using P6 chemistry on a RS II instrument (Pacific Biosystems) ...
-
bioRxiv - Genomics 2023Quote: The cDNA was circularized by incubation with Circligase (Lucigen) for 3 h at 60 °C in a 10 µL reaction as described54 ...
-
bioRxiv - Genomics 2023Quote: ... Linearized plasmids were used for in vitro transcription with the AmpliScribe T7-Flash Transcription Kit (Lucigen, ASF3507) using 5-Methyluridine-5’-Triphosphate (5-mUTP ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA (rRNA) was depleted from each RNA sample using the Ribo-ZerorRNA Removal Kit (Epicentre), designed for human ...
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using Lucigen MasterPure Yeast DNA Purification Kit (Lucigen, Middleton, WI, USA). DNA concentration was measured by bio-spectrophotometer absorbance readings and diluted to desired target concentrations.
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Molecular Biology 2023Quote: DNA from GFP-positive cells was isolated using QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... from ClearColi (Lucigen) were purified using a Ni-affinity column ...
-
bioRxiv - Molecular Biology 2023Quote: Remaining linear DNA molecules were digested with Plasmid-Safe ATP-dependent exonuclease (Epicentre) continuously at 37°C for 120 h ...
-
bioRxiv - Microbiology 2023Quote: ... 50 U/μL Ready-Lyse Lysozyme Solution (Lucigen, WI, USA), 2 U/mL Zymolyase (Zymo Research Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... 300 μl of yeast cell lysis solution (from Epicentre MasterPure Yeast DNA Purification kit), 0.3 μl of 31,500 U/μl ReadyLyse Lysozyme solution (Epicentre ...
-
bioRxiv - Microbiology 2023Quote: ... 0.3 μl of 31,500 U/μl ReadyLyse Lysozyme solution (Epicentre, Lucigen, Middleton, WI), 5 μl of 1 mg/ml mutanolysin (M9901 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 0.3 μl of 31,500 U/μl ReadyLyse Lysozyme solution (Epicentre, Lucigen, Middleton, WI), 5 μl of 1 mg/ml mutanolysin (M9901 ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated using the MasterPure Yeast RNA Purification Kit (Epicentre). cDNA was synthesized using the PrimeScript RT Master Mix (Takara).
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was conducted using EconoTaq PLUS 2X Master mix (Cat no. 30035-1, Lucigen, LGC Biosearch technologies, USA) as follow ...
-
bioRxiv - Immunology 2023Quote: ... Immediately after electroporation 1 ml of prewarmed recovery medium (Lucigen, #800261 was added to the bacteria and the cells were incubated for 1 hour at 37 °C shaking at 250 rpm in a bacterial incubator ...
-
bioRxiv - Genomics 2023Quote: ... cloni 10G ELITE Electrocompetent Cells (Lucigen 60052-4) in 1mm cuvette (Bio-Rad 1652089 ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the assembled library plasmid pool was electroporated into Endura cells (Lucigen, Cat #60242-2) at 50-100 ng/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain EPI300 (Epicentre, USA) under chloramphenicol selection for attB libraries ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL TypeOne Restriction Inhibitor (Lucigen, USA) and 0.4 µL transposome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposomes were prepared using 100 ng transposon DNA and EZ-Tn5 transposase (Lucigen, USA) according to the suppliers specifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ATAC-see in 293T cells was done with the EZ-Tn5™ Transposase (Lucigen TNP9211), following the published protocol36 ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of cells were mixed with EZ-Tn5TM
transposome (Lucigen) and incubated on ice for 30 min ... -
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... The electroporated cells were recovered in recovery medium (Lucigen) for 1 h and then plated on Terrific Broth (TB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three hundred nanograms of purified plasmids were electroporated into 25 µl of Endura electrocompetent cells (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... A piece of embryonic tail was taken from each embryo and DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... shRNAs were synthesized with AmpliScribe T7-Flash Transcription Kit (Epicentre, Charlotte, NC) for 15 h followed by 15 min treatment with 1 µl of DNase I ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2min at 72 C) using the EconoTaq Plus protocol (Lucigen, Middleton, WI, United States). The PCR products were then digested ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNAs from single clones were extracted using QuickExtract DNA extraction solution (QE0905T; Lucigen), and PCR products containing the site of Cas9 targeting site were generated using the following primers ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from 2.5×105 Neuro2A cells with 250 μL of QuickExtract DNA Extraction Solution (Lucigen, Middleton, WI, USA) or from 30 mg of mouse liver using a EZ-10 Spin Column Animal Genomic DNA Miniprep Kit (Bio Basic ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 U/µL Nxgen RNase inhibitor (Lucigen), and 0.1% Tween 20 (blocking buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: A transposon mutant library for the WT strain was generated by electroporation using the EZ-Tn5
Tnp transposome kit (Lucigen Inc.). The library consisted of approximately 40,000 insertion mutants ... -
bioRxiv - Evolutionary Biology 2023Quote: ... cloni 10G (Lucigen, Middleton, WI, United States) reliably yielded >20 ...
-
bioRxiv - Bioengineering 2023Quote: ... We synthesized mRNA using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, catalog #ASF-3507) as described previously.(79 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Biochemistry 2023Quote: ... cloni 10F ELITE Electrocompetent cells (Lucigen), and plated on two 140 mm Petri dishes containing LBkan-agar ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA of 3T3 cells was isolated with QuickExtractTM DNA Extraction Solution 1.0 (QE09050, Lucigen). Presence of the homozygous deletion was confirmed by PCR using specific primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The remaining nDNA contamination was removed by treatment with Plasmid-Safe ATP-Dependent DNase (Lucigen) to digest linear DNA53 ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The resulting ligated DNA was transformed into electrocompetent cells E.coli SS320 (Lucigen) and propagated overnight.
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Biophysics 2023Quote: ... The 3′ ligation oligo (listed in Supplemental Table S6) was ligated onto the cDNA using CircLigase I (Lucigen #CL4111K, 100 units) with CircLigase Reaction Buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... EconoTaq Plus Greeen (30033, Lucigen) was purchased ...
-
bioRxiv - Cancer Biology 2023Quote: ... purified and then circularized (CircLigase, Lucigen). Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8 ...