Labshake search
Citations for Lucigen :
751 - 800 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The RNA 5’ ends were dephosphorylated using Heat Labile Alkaline phosphatase (Epicentre), purified using ZYMO columns and treated with RNA 5’ Pyrophosphohydrolase (RppH ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Biophysics 2023Quote: ... The 3′ ligation oligo (listed in Supplemental Table S6) was ligated onto the cDNA using CircLigase I (Lucigen #CL4111K, 100 units) with CircLigase Reaction Buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The remaining nDNA contamination was removed by treatment with Plasmid-Safe ATP-Dependent DNase (Lucigen) to digest linear DNA53 ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The resulting ligated DNA was transformed into electrocompetent cells E.coli SS320 (Lucigen) and propagated overnight.
-
bioRxiv - Biochemistry 2023Quote: ... cloni 10F ELITE Electrocompetent cells (Lucigen), and plated on two 140 mm Petri dishes containing LBkan-agar ...
-
bioRxiv - Biochemistry 2023Quote: ... cloni 10F ELITE Electrocompetent cells (Lucigen), and plated on two 140 mm Petri dishes containing LBkan-agar ...
-
bioRxiv - Bioengineering 2023Quote: ... We synthesized mRNA using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, catalog #ASF-3507) as described previously.(79 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA of 3T3 cells was isolated with QuickExtractTM DNA Extraction Solution 1.0 (QE09050, Lucigen). Presence of the homozygous deletion was confirmed by PCR using specific primers ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the bacterial pellets using the MasterPure™ Complete DNA and RNA purification kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Individual colonies were selected and subcultured in THM to stationary phase and genomic DNA prepared using the Masterpure Gram-positive DNA purification kit (Lucigen, Middleton, WI). The samples then were purified further using ZymoDNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: ... The electroporated cells were recovered in recovery medium (Lucigen) for 1 h and then plated on Terrific Broth (TB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three hundred nanograms of purified plasmids were electroporated into 25 µl of Endura electrocompetent cells (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zeroTM rRNA Removal Kit (Epicentre ...
-
bioRxiv - Systems Biology 2023Quote: ... Lysate containing 20 µg of total RNA was digested with 10 U of RNase I (Lucigen, WI, USA) for 45 min at 25°C ...
-
bioRxiv - Bioengineering 2023Quote: Edited cells were harvested and treated with Quick Extraction solution (Epicentre, Madison, WI) to lyse the cells (65 °C for 20 min and then 95 °C for 20 min) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Supernatant were carefully discarded and the isolated hair cells were lysed by 5μl QuickExtract™ DNA Extraction Solution (Lucigen) and incubated in 65°C for 6 min then 98°C 3 min ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated using the MasterPure™ Yeast RNA purification kit (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Isolated RNA was DNase-treated (Lucigen, DB0715K), cleaned and concentrated (Zymo ...
-
bioRxiv - Immunology 2023Quote: ... The ligation reaction was purified and transformed into TG1 bacteria (Lucigen) by electroporation (1.8 kV ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zeroTM rRNA Removal Kit (Epicentre, USA), and rRNA- free residue was cleaned up by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid-safe ATP-dependent DNase treatment was carried out according to the manufacturer’s protocol (Epicenter, Lucigen) with using 1 μg of total DNA extracted from SDGC-SEC-purified stress granule cores and 3 units of the enzyme per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6.25 units RNase I (Epicentre) was added to 5ul of sample in a total volume of 50 ul in IP buffer supplemented with 0.1% Igepal ...
-
bioRxiv - Molecular Biology 2023Quote: ... The products were then packaged into phage particles using phage extract (MaxPlax, Epicentre) and amplified by lytic growth in LE392 cells (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... genomic DNA was extracted from transfected cells using the QuickExtractTM DNA Extraction Solution (Lucigen) and mutations were detected by the SURVEYOR assay (Integrated DNA technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The shRNA and mimiRs were transcribed according to the manufacturer’s instructions using the AmpliScribe™ T7-Flash™ Transcription kit protocol (Lucigen, USA) with a few changes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Immunology 2023Quote: ... 10 µl of the reaction were electroporated in 50 µl Lucigen Endura electro competent cells (Lucigen, #602421) using 1 mm electroporation cuvettes (Biorad ...
-
bioRxiv - Molecular Biology 2023Quote: ... After treatment with Rnase A (Epicentre) at 37°C for 20 minutes and Proteinase K (Roche ...
-
bioRxiv - Genomics 2023Quote: ... and gel- purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described36 and libraries constructed using a different reverse indexing primer for each sample.
-
bioRxiv - Synthetic Biology 2023Quote: ... Eluates were drop-dialyzed against 30 mL of water for 1 hour and transformed (Lucigen E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Failsafe Buffer D (Epicentre). PCR products were run on a 1% agarose gel and imaged using a Gel Doc XR+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: One swab each was stored in 350 μl Tissue and Cell lysis solution (Lucigen, #MTC096H, Middleton, WI) lysis buffer with 100 μl glass beads (0.1 diameter ...
-
bioRxiv - Microbiology 2023Quote: ... 20 Units RNase R (Lucigen), 100 mM LiCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified cDNA was circularized using CircLigase II enzyme (Epicentre, CL9025K), then library PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ribosomal RNAs were depleted using the Gram-negative bacteria RiboZero rRNA Removal Kit (Epicentre). Final eluates were used as input for strand-specific RNA-seq library construction using the NEBNext RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Immunology 2023Quote: ... Circular ligation was performed using CircLigase II ssDNA Ligase (Epicentre CL4111K) for 1,5 hours at 60°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5 U/μL Ampligase (Lucigen A3210K) and 50 nM dNTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... either into pCC1FOS™ plasmid (Epicentre, USA) for attB libraries ...
-
bioRxiv - Genomics 2023Quote: ... The eluted RNA was then treated with 5’ Terminator exonuclease enzyme (Epicentre) to remove the uncapped RNA ...
-
bioRxiv - Genomics 2023Quote: ... Two 40 Kb mate-pair libraries were generated by Lucigen from 1 µg of gDNA using the CviQl and BfaI restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR-amplified NLuc gene block was transcribed using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, ASF-3507) following manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... each reaction mixtures were transformed into Endura™ electro-competent cells (Lucigen, CAT. 60242-1) and transformed bacteria were selected on LB + Ampicillin plates ...
-
bioRxiv - Bioengineering 2023Quote: Edited cells were harvested and treated with Quick Extraction solution (Epicentre, Madison, WI) to lyse the cells (65 °C for 20 min and then 95 °C for 20 min) ...