Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed 3 times with PBS and then lysed using Trizol Reagent (Thermo Fisher Scientific, 15596026). The qRT-PCR for the detection of viral RNA was performed as previously described (Monteil et al. ...
-
bioRxiv - Immunology 2020Quote: ... was added to 3 × 106 leukemia/lymphoma cells in 500 μl Hank’s Balanced Salt Solution (HBSS; Invitrogen) and 10% FCS (HBSS-10) ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were washed 3 times with PBS and an aliquot of 1 ml of warmed TrypLE (Gibco) added to each well and incubated at 37°C for 10 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed 3 times with PBS and incubated with fluorophore-labeled appropriate secondary antibodies (Life Technologies). Phalloidin staining was performed using GFP-coupled Phalloidin-Atto 488 (49409 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 10μg total sgRNA (Synthego) using the Neon electroporator (3×106 cells per 100μl tip) (Life Technologies) using parameters 1400V ...
-
bioRxiv - Molecular Biology 2021Quote: ... 30μg pX330 plasmids were introduced into ∼3 × 106 PK-15 cells resuspended in 300μL Opti-MEM (Gibco) in 2 mm gap cuvettes using BTX-ECM 2001 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were permeabilised in 0.1% Triton in PBS and blocked in 3% bovine serum albumen (ThermoFisher Scientific) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Microbiology 2020Quote: ... Drosten) was propagated to passage 3 on VeroE6 cells (ATCC) in Opti-MEM I (1X) + GlutaMAX (Gibco), supplemented with penicillin (10,000 IU mL−1 ...
-
bioRxiv - Immunology 2021Quote: ... with confluent bEnd.3 cell monolayers or pre-coated with collagen I (1 mg/ml, Life Technologies), and allowed to adhere for 10 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were routinely passaged after 2-3 days or after reaching ∼80 % confluency using TrypLE Express (Gibco) for the detachment of cells from culture flasks ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were subcultured every 3-4 days by washing with Dulbecco’s phosphate buffered saline (DPBS, GibcoTM, ThermoFisher) and detached with trypsin (GibcoTM ...
-
bioRxiv - Genetics 2022Quote: ... Cells were passaged at 70-80% confluence every 2-3 days using Trypsin 0.25% EDTA (Life Technologies). mESCs were plated at a density of 1 x 105 cells/ml ...
-
bioRxiv - Immunology 2022Quote: ... 3×106 HEK-293T cells were seeded in 10ml of complete DMEM Dulbecco’s Modified Eagle’s Medium (Gibco) supplemented with 10% FBS and 50μg/ml penicillin-streptomycin ...
-
bioRxiv - Pathology 2024Quote: Gene expression on human cells and tissue was quantified using TaqManTM assays (Fisher Scientific, Supplementary Table 3) and Luna® Universal qPCR Master Mix (M3003E ...
-
bioRxiv - Neuroscience 2023Quote: Passage matched (±3) human induced pluripotent stem cells (hiPSCs) were cultured in StemFlex media (Life technologies #A3349401) on Matrigel (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... counted and total RNA was recovered from 3×106 cells using 1 ml of Trizol (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed 3 times with block/perm buffer and stained with Dapi nuclear stain (ThermoFisher 62248) diluted in fix/perm buffer for 10 minutes at RT ...
-
bioRxiv - Genomics 2024Quote: ... The cells were counted and assessed for viability using trypan blue staining on Countess 3 (Thermo Scientific). After all ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 1 µg of plasmid library using 3 µl Lipofectamine 3000 reagent (L3000008, Invitrogen, Carlsbad ...
-
bioRxiv - Immunology 2024Quote: ... Erythrocytes in spleen and liver cell suspensions were lysed for 3 min in ACK Lysing Buffer (Gibco). Heart and SM (quadriceps ...
-
bioRxiv - Immunology 2024Quote: Plasmid DNA was transfected into Calu-3 cells applying Lipofectamine 3000 following supplier’s instructions (Thermo Fisher Scientific). Plasmid DNA was also nucleofected into 721.221 cells using Lonza’s Kit-V by Nucleofector II electroporation-based transfection system according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... PFA was removed with 3 PBS washes and the fixed cells were staining with Hoechst 33342 (Invitrogen, cat# H3570 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then washed 3 times with PBST and incubated with secondary antibody and DAPI (D1306, Invitrogen) in 3% BSA PBST for 1 hour at RT in darkness ...
-
bioRxiv - Cell Biology 2023Quote: ... At 3 hours post infection (hpi) cells were seeded on 5 mm round glass coverslips (Thermo Scientific) and mounted on a sample holder specially designed for LLSM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single cells were prepared in 3 ml enzyme-free dissociation buffer (Gibco, Thermo Fisher Scientific, Waltham, MA) incubated in a 37 °C water bath for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were then washed with PBS 3 times and incubated with 1:10,000 DAPI (Invitrogen, Cat#D1306) for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then scraped off and sonicated for 3 pulses at 20% (550 sonic dismembrator, Fisher Scientific). Cells were then centrifuged for 15 minutes at 15,000 x g at 4 degrees ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single cells were prepared in 3 ml enzyme-free dissociation buffer (Gibco, Thermo Fisher Scientific, Waltham, MA) incubated in a 37 °C water bath for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed 3 times with 1X PBS and then incubated with AlexaFluor-conjugated secondary antibodies (Invitrogen) in 1% BSA in a humidified chamber at room temperature for 1 hr ...
-
bioRxiv - Immunology 2023Quote: ... The next day cells were labelled for 1LJh with medium containing 3 µM calcein-AM (Molecular Probes), washed 3 times and incubated in fresh medium for a further hour to release free dye ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells are washed atleast 3 times in PBS+0.05% tween and stained with DAPI (Invitrogen #62248) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were incubated with 1.2mM 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific) solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were blocked in 3% BSA in PBST (PBS from Gibco supplemented with 0.1% Tween-20) for at least 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293 cells were transfected with 3 μg of linearised plasmid using Lipofectamine 3000 Transfection Reagent (Invitrogen, #L3000001) in wells of a 6-well plate ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were passaged every 3-5 days at 70-80% confluence using 0.25% Trypsin-EDTA (Life Technologies). Cells were grown at 37°C in 5% CO2.
-
bioRxiv - Immunology 2024Quote: ... Cell suspensions were strained through 40 μm filters and counted on a Countess 3 (Thermo Fisher Scientific) using Trypan Blue to exclude dead cells ...
-
bioRxiv - Cell Biology 2024Quote: Cells were washed 2x with PBS and gently dissociated with 1:3 diluted Accutase (Gibco, A11105-01). Lifted cells were washed 2x with cold dPBS (HyClone ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Physiology 2023Quote: ... Samples (3 μL corresponding to 600 ng of protein) were loaded on to the trapping column (Thermo Scientific, PepMap100, C18, 75 μm X 20 mm), using partial loop injection ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples (3 μl corresponding to 600 ng of protein) were loaded on to the trapping column (Thermo Scientific, PepMap100, C18, 75 μm X 20 mm), using partial loop injection ...
-
bioRxiv - Molecular Biology 2024Quote: ... Knockdown of the protein was monitored by western blotting against the V5×3 epitope using α-V5 mouse primary antibody (Invitrogen / Thermo Fisher Scientific – 1:1000). Oligonucleotides used for PCR amplification are given in Table S4.
-
bioRxiv - Cell Biology 2023Quote: ... The bead-bound biotinylated proteins were analyzed by Western blotting using HRP-streptavidin diluted 1:40 000 in 3% BSA/TBST (Thermo Fisher Scientific, Rockford, IL, USA) and identified by mass spectrometry.