Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 10000+ citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... HT914 and HT915 iPSC lines) using the integration-free CytoTune 2.0 Sendai virus reprogramming kit (A16517, Thermo Fisher Scientific) as previously reported [43–45] ...
-
bioRxiv - Microbiology 2023Quote: ... The RT-PCR was performed using the Taqman Fast Virus 1-step master mix (Applied Biosystems, Foster City, CA) on a QuantStudio3 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells infected with pLENTI-Luciferase-expressing virus (generous gift of Charlotte Kuperwasser, Tufts University) were selected with neomycin (G418, 500μg/mL, Gibco) for 2-3 weeks ...
-
bioRxiv - Molecular Biology 2023Quote: ... MED1-IDR containing plasmid was obtained from Addgene #145276 and inserted into pcDNATM6.2-C-EmGFP-DEST supplemented with the Simian Virus 40 NLS sequence by Gateway strategy (Invitrogen) using primers described in Suppl ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was reverse-transcribed using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (RT) according to the manufacturer’s instructions (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we extracted virus from the pooled samples from each assay grid using a sterile pellet pestle (Fisher Scientific, U.S.A.) to manually burst larvae and release viral occlusion bodies ...
-
bioRxiv - Cell Biology 2024Quote: ... the virus titer was quantified using quantitative polymerase chain reaction (qPCR) with SYBR Green Master Mix (Thermo Scientific, 4309155) and primers targeting ITRs (Supplementary Table 1) ...
-
bioRxiv - Biophysics 2024Quote: ... at a 6:1:2 ratio for each virus using the Bac-to-Bac baculovirus expression system (Thermo Fisher). Cell cultures were grown in ESF 921 medium (Expression Systems ...
-
bioRxiv - Immunology 2024Quote: ... RNA was then reverse transcribed from 200 ng total RNA with Moloney murine leukemia virus reverse transcriptase (Invitrogen #28025013) using oligo (dT)18 (Thermo Scientific #SO131 ...
-
bioRxiv - Physiology 2024Quote: ... and infected with sendai virus (SeV) carried polycistronic Klf4-Oct3/4-Sox2 and Klf4 vectors (ThermoFisher, Waltham, MA, #A16517), here referred as OSK-SeV ...
-
bioRxiv - Genomics 2020Quote: ... and Protein A or Protein G Dynabeads (Invitrogen). After incubation ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein reagent (Thermo Scientific PierceTM BCA Protein assay) was added to the supernatant and the standards and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... or with Dynabeads protein A/protein G (Thermofisher) combined with Abatacept ...
-
bioRxiv - Biochemistry 2021Quote: ... protein marker (NativeMark Unstained protein standard, LC0725, ThermoFisher) was diluted 50x in the working buffer (40 mM HEPES pH 7.5) ...
-
bioRxiv - Immunology 2020Quote: ... protein A and protein G magnetic beads (Invitrogen) were added to capture the antibody-chromatin complexes ...
-
bioRxiv - Immunology 2021Quote: ... For protein purification protein G dynabeads (Thermo Fisher), coupled with 2.5 µg of antibody (Table S8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Magentic dynabeads Protein G or Protein A (Invitrogen) were washed with 0.05% Triton X-100 in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein A and Protein G Dynabeads (Thermofisher Scientific) were washed twice with IP dilution buffer (150 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... Magnetic Protein A and Protein G Dynabeads (Invitrogen) were added and incubated at 4°C for two hours ...
-
bioRxiv - Plant Biology 2022Quote: ... Magnetic Protein A and Protein G Dynabeads (Invitrogen) were added and incubated at 4 °C for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration in cell lysates was measured with a Pierce™ BCA Protein Assay and or a Pierce™ Enhanced BCA Protein Assay (Thermo Fisher Scientific, USA) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Total protein concentrations of tissue and cancer cell samples were determined using the Pierce BCA Protein Assay Kit (#RG235622, Thermo Fisher Scientific, Waltham, MA, USA). Further steps were performed as described for protein isolation from mouse organ tissues.
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Immunology 2021Quote: 293T cells grown in 96-well plates (3-4×104 cells / well) were co-transfected by Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA USA) with reporter plasmids ...
-
bioRxiv - Immunology 2021Quote: ... 2×108 spleen cells and inguinal lymph node cells (about 1×108 B cells) were mixed with 108 Sp2/0 cells and washed 3 times with RPMI1640 medium (Gibco, Thermo Fisher Scientific, Waltham, USA) without FCS ...
-
bioRxiv - Immunology 2021Quote: ... and were then transfected into Expi293F cells at a density of 3×106 cells/ml using ExpiFectatmine 293 transfection kit (Gibco, ThermoFisher Scientific, MA, USA). The supernatant of cell culture containing the secreted RBDs was harvested 96 h after infection ...
-
bioRxiv - Immunology 2021Quote: ... and were then transfected into Expi293F cells at a density of 3×106 cells/ml using ExpiFectatmine 293 transfection kit (Gibco, ThermoFisher Scientific, MA, USA). The supernatant of cell culture containing the secreted RBDwt or RBDmut was harvested 96 h after infection ...
-
bioRxiv - Immunology 2021Quote: ... and the extracted plasmid was then transfected into HEK293F cells at a density of 3×106 cells/ml using PEI (Invitrogen, Thermo Fisher Scientific, MA, USA). The supernatant of cell culture containing the secreted RBD was harvested 72 h after infection ...
-
bioRxiv - Immunology 2024Quote: Vero-CCL81 [for MuV and VSV_RUBV] or Vero-hSLAM [for MeV-IC323] target cells which were seeded at a density of 2 × 104 cells per well in flat-bottom 96-well plates (Fisher Scientific, #08-772-3). The cells were incubated at 37 °C/5% CO2 overnight (∼20 hours) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATTO 550+ cells were sorted by flow cytometry and the 3% most positive cells were seeded at 1 cell per well in alpha minimal essential medium (αMEM, Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen, Waltham, MA, USA). 5 µg of each protein fraction was added to 1x loading buffer (250 mM Tris pH 6.8 ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cell Biology 2019Quote: ... The extraction of surface proteins in strained and non-strained cells was performed by following the instruction provided by Pierce Cell Surface Protein Isolation Kit (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 isolated T cells were then stimulated at 37°C with eBioscience™ Cell Stimulation Cocktail plus protein transport inhibitors (Invitrogen) for 6 hours ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2021Quote: ... total cell protein lysates were obtained by lysing cells exposed to 100 nM 4-OHT with RIPA buffer (Thermo Fisher, #89900) containing phosphatase inhibitor cocktail 1 and 2 (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... cells were harvested in parallel either as a whole cell lysate (WCL) or for processing with the subcellular protein fractionation kit for cultured cells (Thermo Fisher) following manufacturer’s instructions ...