Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... pRS1841 was PCR-amplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and sdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase (Thermo Fisher Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid pRS1951 ...
-
bioRxiv - Microbiology 2024Quote: ... coli BL21 (DE3) cells (Thermo Fisher Scientific, Waltham, Massachusetts) following the method of Inoue (Inoue et al. ...
-
bioRxiv - Microbiology 2024Quote: ... in 0.2 M HEPES (pH 7.2– 7.4, Gibco 15630080) for 20 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification was achieved by using Power SYBR Green PCR Master Mix (ThermoFisher Scientific) and QuantStudio 6 Flex real-time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The viral media overlayed on the sorbitol cushion was applied to a Sorvall WX-90 ultracentrifuge and SureSpin 630 rotor (Thermo Scientific) at 20,000 rpm for 1.5 hours at 18°C ...
-
bioRxiv - Microbiology 2024Quote: ... The cell nuclei were stained with a 0.05% Hoechst 33342 solution (Thermo Fisher Scientific) in PBS (+ ...
-
bioRxiv - Microbiology 2024Quote: ... harvested cells by centrifugation (10,015 x g, 5 min, 4 °C, Heraeus Biofuge Primo R, Thermo Scientific), washed the cell pellets twice in TE buffer (10 mM Tris ...
-
bioRxiv - Microbiology 2024Quote: ... goat anti-mouse Alexa Fluor 647 (A21235, Invitrogen), goat anti-rabbit Alexa Fluor 647 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The GlnK1 gene was PCR-amplified using primers GlnK1_MM0732.for (5’ATGGTTGGCTATGAAATACGTAATTG3’) and GlnK1_MM0732.rev (5’TCAAATTGCCTCAGGTCCG3’) and cloned into pETSUMO by using the Champion™ pET SUMO Expression System (Thermo Fisher Scientific, Waltham, Massachusetts) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The plated cells were washed twice with Hanks’ Balanced Salt Solution (HBSS, Gibco cat # 14025-092), and 50 μL of HBSS was added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... SUMO-protease (Thermo Fisher Scientific, Waltham, Massachusetts) was used according to the manufacturer’s protocol to cleave the His6-SUMO-GlnK1 and obtain untagged GlnK1 by passing through the Ni-NTA-column after the cleavage ...
-
bioRxiv - Biochemistry 2024Quote: ... 100X L-Glut 200 mM (250030-024, Thermo Scientific, Germany) and 1 mM Sodium-pyruvate (for RPMI only ...
-
bioRxiv - Immunology 2024Quote: ... Samples were injected and concentrated on a trap column (PepMap100 C18, 3 μm, 100 Å, 75 μm i.d. × 2 cm, Thermo Fisher Scientific) equilibrated with 0.05 % TFA in wather ...
-
bioRxiv - Immunology 2024Quote: ... the RNA pellet was re-suspended in 20µl of DNase RNase-free water (Gibco, Life Technologies, NY, USA). RNA purity and quantity were checked by Nanodrop 2000c.
-
bioRxiv - Immunology 2024Quote: ... and 5 ug/mL Gentamycin (Life Technologies, cat#15750060). Cells were then passed through a 40 µM cell strainer and resuspended in 44% Percoll (Fisher ...
-
bioRxiv - Immunology 2024Quote: ... alligator, anole and platypus gasdermins were synthesized by TwistBioscience (South San Francisco, CA, USA) and cloned using Gateway technology (ThermoFisher, Waltham, MA, USA) into a pCMV-polysite (Agrotis et al. ...
-
bioRxiv - Immunology 2024Quote: Gene knockdowns in cells were achieved through RNA interference (RNAi) using Lipofectamine™ RNAiMAX Transfection Reagent from ThermoFisher Scientific (catalog number 13778075) ...
-
bioRxiv - Immunology 2024Quote: ... 10% heat-inactivated fetal bovine serum (FBS, Gibco), 100 U/ml penicillin (Beyotime) ...
-
bioRxiv - Immunology 2024Quote: ... and loaded in 4–12% NuPAGE Bis-Tris gels (ThermoFisher; #NP0322). The gel was run in 1 × MES SDS running buffer (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... 1x penicillin/streptomycin/glutamine solution (Gibco #10378016), and 10 mM HEPES (HyClone #SH30237) ...
-
bioRxiv - Immunology 2024Quote: ... Gel was prepared with 0.5 × TBE buffer with 11 mM MgCl2 and 0.005% v/v SYBR Safe (ThermoFisher #S33102), run at 70V for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... Nunc Maxisorp ELISA plates (Thermo Fisher Scientific Inc., USA #44-2404-21) were coated with HR2 peptide (SARS-CoV-2 ...
-
bioRxiv - Immunology 2024Quote: ... and DAPI (D1306, Thermo Fisher Scientific), according to manufacturer recommendation ...
-
bioRxiv - Immunology 2024Quote: ... ELISA plates (Nunc) were coated with goat anti-mouse Ig (SouthernBiotech ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stained for viability discrimination using PI (P3566, Thermo Fisher Scientific), and were sorted for downstream purposes ...
-
bioRxiv - Immunology 2024Quote: ... 1 × TE buffer (5 mM Tris base, pH 8.0 and 1 mM EDTA acid) containing 15% w/v PEG-8000 (Fisher Scientific, BP2331) and 510 mM NaCl was added to the SQB sample at 1:1 volume and mixed gently via pipetting ...
-
bioRxiv - Immunology 2024Quote: ... M2C transformed colon epithelial cells (Padilla-Nash et al., 2012) were maintained with Advanced DMEM/F12 blend (Gibco #12634010) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... and cast into a cassette (ThermoFisher Novex #NC2010)55 ...
-
bioRxiv - Immunology 2024Quote: ... Viability (92% avg.) was then re-assessed by Trypan Blue staining (15250061, Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: Splenocytes were depleted for CD4 or CD8 T cells using CD8 DynabeadsTM (Thermofisher, #11145D) or CD4 Microbeads (Miltenyi Biotec ...
-
bioRxiv - Immunology 2024Quote: ... and fixed volumes of cells were processed with the Attune® NxT Acoustic Focusing Cytometer (Thermo Scientific). Data were analyzed by FlowJo software (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: BV2 (macrophage) cells and HEK 293T cells (ATCC #CRL-3216) were maintained in DMEM (Gibco #11995065) with 5% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: ... dPAGE gel (15%) was made in-house using 9 mL urea concentrate (Fisher Scientific #EC-833), 4.5 mL urea dilutant ...
-
bioRxiv - Immunology 2024Quote: ... All cells and organoids were lifted and disrupted using trypsin/EDTA (Gibco #2500).
-
bioRxiv - Immunology 2024Quote: ... nuclei were stained with Trypan Blue (15250061, Thermo Fisher Scientific), and DAPI (D1306 ...
-
bioRxiv - Immunology 2024Quote: ... or adsorbed onto Imject Alum (Thermo Scientific, 1:1), or with the TID-Ag NP-AECM-Ficoll (NP-Ficoll)/NP-LPS intraperitoneally ...
-
bioRxiv - Immunology 2024Quote: ... mRNA levels of indicated genes were quantitatively determined by SYBR-green technology on an ABI-StepOnePlus Sequence Detection System (Applied Biosystems). Sequence of primers used for RT-qPCR analysis were listed in Table S2.
-
bioRxiv - Immunology 2024Quote: ... organoids were dissociated from Matrigel using trypsin/EDTA (Gibco #2500), washed with PBS ...
-
bioRxiv - Immunology 2024Quote: ... Samples were run on a 12% Bis-Tris Bolt Mini protein gel (ThermoFisher) and transferred to a PVDF membrane using Bolt transfer buffer (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... Slides were counter-stained with DAPI and mounted with ProLong Gold antifade reagent (ThermoFisher). Fluorescent micrographs were captured using a Zeiss ApoTome2 on an Axio Imager ...
-
bioRxiv - Immunology 2024Quote: ... centrifuged at 500g for 10 minutes at 4°C and resuspended in 0.25% Trypsin-EDTA (Thermo Fisher Scientific, #25200-072) at 37°C for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% FBS (Thermo Fisher Scientific, #10438026) and 1% penicillin/streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Heads were shaved and cleaned using 70% ethanol and Betadine (Thermo Fisher, #19-027132) followed by a medial incision of the skin to expose the skull ...
-
bioRxiv - Immunology 2024Quote: ... Trypsin was neutralized by adding DMEM (Thermo Fisher Scientific, # 11965118) supplemented with 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... DNA contamination was removed using the Turbo DNAfree kit (ThermoFisher #AM1907). cDNA was generated with the ImPromII reverse transcription system (Promega #A3800) ...
-
bioRxiv - Immunology 2024Quote: ... and 1% penicillin/streptomycin (Life Technologies, #15140122) or PBS ...
-
bioRxiv - Immunology 2024Quote: ... Fluoromyelin dye (Thermo Fisher Scientific, 1:300, #F34652) were stained in 1X permeabilization buffer (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... and 1% penicillin/streptomycin (Thermo Fisher Scientific, #15140148), and cells were passed through a 70µm cell strainer ...
-
bioRxiv - Immunology 2024Quote: ... cells were stained with a goat anti-rabbit IgG antibody conjugated to Alexa 647 (ThermoFisher #A21244) in perm/block for 30 minutes at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... The conjugated antibody used in this study was mouse anti-GFAP Alexa Fluor 488 (GA5) (Fisher Scientific, 1:100, #53-9892-82). For FluoroMyelin