Labshake search
Citations for New England Biolabs :
4951 - 5000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA sequencing libraries were generated using the poly-A selection module in the NEBNext UltraII Directional RNA Library Prep Kit (NEB E7760) and sequenced on the Illumina HiSeq 2500 sequencer with single-end 50 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein-coding or lncRNA genes with adjusted P-value < 0.05 and absolute log2 fold change > 1 (NEB Directional RNA-seq) or with adjusted P-value < 0.05 and absolute log2 fold change > 0 (QuantSeq 3’ mRNA-seq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative RT-PCR was conducted with the Luna Universal One-Step RT-qPCR Kit (NEB, E3005) on a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the luciferase gene was replaced with the cGAS or EGFP sequences using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621). The pAAV:cTnT::GFP-icGAS vector was generated by inserting the catalytically-inactive cGAS (icGAS ...
-
bioRxiv - Molecular Biology 2024Quote: ... The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs) and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were qualified on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit and quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB, E7630). Equal molarity of each library was pooled and subjected to sequencing on Illumina NovaSeq 6000 platform at the McGill University and Génome Québec Innovation Centre to generate 100 bp paired-end reads.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was performed using NEB primers for 15-16 cycles using the Q5 Hot Start HiFi PCR Master Mix (NEB). The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragments were generated using oligonucleotides ordered from Integrated DNA Technologies (IDT) and Q5 High Fidelity DNA Polymerase 2X master mix (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... the vectors were double digested with restriction enzymes (New England BioLabs; NEB) following the standard digest protocols ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.5 U/µL T4 PNK and USER Enzyme (NEB, USA). The reaction was incubated for 15 min at 25°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We repaired the DNA with USER (Uracil-Specific Excision Reagent) Enzyme (NEB, USA) for deanimation ...
-
bioRxiv - Neuroscience 2024Quote: ... and were ligated using Gibson assembly (E2611S, NEB). Ligated plasmids were introduced into NEB Stable Competent E ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR fragments were amplified using Q5 polymerase (M0494S, NEB). Both vectors and PCR fragments were purified using gel electrophoresis and gel extraction (28706 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All treated RNA samples were used for library preparation using NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB #E7300/7580) according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... we performed a streptavidin extraction (New England Biolabs, 150 μl per sample) for 30 minutes at room temperature using streptavidin-linked magnetic beads ...
-
bioRxiv - Molecular Biology 2024Quote: ... to a final volume of 800 µl after washing it with 1x T4 ligase buffer (NEB) (2,500 xg ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated in buffer IIa (0.2% SDS, 1x NEBuffer 3.1; NEB) for 10 min at 50 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed on beads using NEBNext ChIP-Sequencing Library Prep Master Mix Set for Illumina (NEB). The manufacturer’s instructions were followed ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 35 µl rSAP (NEB) were added and sample was incubated for at least 8 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were annealed (81 µl of each Oligo 100 µM, 1x T4 ligase buffer; NEB) at 98 °C for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated in buffer IIa (0.2% SDS, 1x NEBuffer 3.1; NEB) for 10 min at 50 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 850 U DpnII (NEB) and 35 µl rSAP (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was resuspended in buffer IV (160 µl annealed oligos, 1.2x T4 ligase buffer, 6,000 U T4 ligase, 1x protease inhibitors; NEB) to a final volume of 800 µl after washing it with 1x T4 ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... For library preparation NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Buffer IIIb (3% Triton X-100, 1x T4 ligase buffer, 1x protease inhibitors; NEB, Sigma-Aldrich) was added to a final volume of 1 ml and sample was incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the nuclei pellet was washed with 1x NEBuffer 3.1 (NEB) and incubated in buffer IIa (0.2% SDS ...
-
bioRxiv - Genomics 2024Quote: ... 20 μl of Cutsmart buffer (NEB), 3 μl each of HinP1I (NEB R0124S) ...
-
bioRxiv - Genomics 2024Quote: ... and PCR amplified for 2 cycles using the NEBNext master mix (NEB M0544L) with Illumina Nextera primers and conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and transformation (chemically competent NEB 5-alpha E. coli) were performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was then extracted from washed beads using Trizol LS and treated with T4 Polynucleotide Kinase (New England Biolabs) to obtain 5’ phosphate ends for subsequent ligations and passed through NucAway columns (Ambion ...
-
bioRxiv - Neuroscience 2024Quote: ... Synonymous mutations in the DBT cDNA were generated with Q5-site direct mutagenesis (NEB, E0554S) by replacing CACTTCCTGAAAACAACTGC with CATTTTTTAAAGACGACCGC in exon 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 U murine RNase Inhibitor (New England Biolabs), 1X RNase R reaction buffer (Abcam) ...
-
bioRxiv - Molecular Biology 2024Quote: ... hnRNPA1 effector domain was amplified from HEK293T cDNA using the Q5 High fidelity polymerase (#M0491S, NEB). Overhanging BsWI sites were added to the oligonucleotides for cloning into the dCasRx plasmid with Quick Ligation kit (M2200S ...
-
bioRxiv - Molecular Biology 2024Quote: ... Overhanging BsWI sites were added to the oligonucleotides for cloning into the dCasRx plasmid with Quick Ligation kit (M2200S, New England Biolabs) (FW ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3µl of annealed oligonucleotides were cloned in 50ng of gRNA backbone vector (previously cut with BbsI-HF and gel extracted) using Quick Ligation kit (#M2200S, New England Biolabs) and transformed in NEB 5-alpha Competent E ...
-
bioRxiv - Neuroscience 2024Quote: ... and assembled into plasmids using NEBuilder HiFi Assembly (New England Biolabs). Cell-specific expression of gain of function alleles in AWC was driven by the ceh-36prom2 AWC promoter (Etchberger et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD46 or PKM whole transcript cDNA was amplified using the Q5 High fidelity polymerase (#M0491S, NEB) and the oligonucleotides indicated in Supplementary Table 4 using the program ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli (C2987I, New England Biolabs). Positive colonies were screened by PCR using GoTaq G2 Hot Start green Master Mix (#M7422 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A circular form of the 3I_RAN FLEXI synthetic oligonucleotide control was generated by incubating the 5’ phosphorylated-3I_RAN FLEXI oligonucleotide (500 ng) with T4 RNA Ligase I (10 U; New England Biolabs) for 2 h at 25°C and 2 min at 95°C ...
-
bioRxiv - Microbiology 2024Quote: ... input and immunoprecipitated DNA were prepared into multiplexed libraries using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). For the RNA-seq library ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Microbiology 2024Quote: ... Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reversely transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the RNA was resuspended in an appropriate volume of RNase-free water supplemented with RNA inhibitors (New England Biolabs). RNA samples were stored at -80°C until further use ...
-
bioRxiv - Molecular Biology 2024Quote: ... In-vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit E2040L, NEB) from the DNA was then carried out ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ligation (T4 DNA Ligase Kit, M0202, NEB) of the resulting products at a 1:3 molar ratio of vector to insert ...
-
bioRxiv - Molecular Biology 2024Quote: ... using specific enzymes tailored for the qTAG cassette and the insertion sequences (AgeI-HF, BamHI-HF, EcoRI-HF, HindIII-HF, KpnI-HF, MluI-HF, NheI-HF, XbaI, XmaI, NEB), followed by ligation (T4 DNA Ligase Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Gibson assembly (Gibson Assembly Master Mix, E2611L, NEB) at a 1:3 molar ratio of vector to fragment for directional cloning into a pUC19 backbone ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep with Sample Purification Beads (NEB E7103S) following the manufacturer’s protocol with 5ng of starting DNA input ...