Labshake search
Citations for New England Biolabs :
4851 - 4900 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... The eluted transposed DNA was subjected to PCR amplification using Q5 High-Fidelity Polymerase (NEB) for 7 cycles ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were used as the template for in vitro transcription (NEB, Cat. E2040S) followed by reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... transcription template was generated by PCR using Q5 high fidelity DNA polymerase (New England Biolabs) with dNTP (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Both the PCR product and the recipient plasmid were digested with XhoI and BamHI (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Genetics 2022Quote: ... PCR product sizes were determined by comparison with 50 bp DNA ladder (New England Biolabs) using ImageLabTM software (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions (50 µl) contained 1.0-unit Phusion DNA polymerase (New England Biolabs catalog # M0419), 1X Phusion HF buffer ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR product was transcribed using HiScribe T7 High Yield RNA Synthesis Kit (E2040S; NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Assembly of PCR fragments with the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs) was used to replace the EBOV VP30 by a (codon-optimized ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR amplification of all target regions was performed using LongAmp Taq 2X Mastermix (NEB #M0287). Amplicon size was verified using gel electrophoresis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently DNA was purified using Monarch PCR & DNA Cleanup Kit (New England BioLabs, #T1030). DNA fragments were amplified with PCR and samples were barcoded using published primers (36) ...
-
bioRxiv - Genetics 2022Quote: ... PCR product sizes were determined by comparison with 50 bp DNA ladder (New England Biolabs) using ImageLab™ software (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments and linearized pDIA6754 (31) were mixed and assembled using Gibson Assembly (NEB, France) and transformed by heat shock in E ...
-
bioRxiv - Plant Biology 2022Quote: ... was PCR amplified and connected to PIN’s start codon using the EcoRI (New England Biolabs) restriction enzyme ...
-
bioRxiv - Plant Biology 2023Quote: PCR amplification was done using Q5 DNA polymerase and manufacturer guidelines (New England Biolabs Ltd.) and all plasmid constructs were generated by standard molecular cloning techniques and confirmed by Sanger DNA sequencing (TGCA Sequencing Centre ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were purified and digested with 10U of lambda exonuclease (New England Biolabs; M0262) in 1X lambda-exonuclease buffer for 2 hours at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: PCRs were performed in 25 μL volumes using Phusion® High-Fidelity DNA polymerase (NEB) or Q5® High-Fidelity DNA Polymerase (NEB ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... PCR amplification of genes of interest for this study was done with Phusion polymerase (NEB). For pET vector cloning the PCR amplicons were digested with restriction endonucleases NdeI/XhoI for pET29b/pETduet-1 MCS2 or BamHI/SalI for pETduet-1 MCS1 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were recovered from PCR reaction mixtures and agarose gels using Monarch kits (NEB). Oligonucleotides were obtained from Integrated DNA Technologies.
-
bioRxiv - Molecular Biology 2022Quote: ... 50 μL PCR reactions for each gene block were carried out with Phusion polymerase (NEB) using primers gblock_fwd and gblock_rev for 35 cycles (denaturing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina Nextera XT SetA indexes and NEBNext High-Fidelity 2X PCR Master mix (NEB, M0541) are used to amplify the fragmented products of each sample ...
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae D39 chromosomal DNA by PCR using Q5 High-Fidelity DNA polymerase (New England Biolabs). The kanamycin cassette was amplified from pSt-K and the streptomycin cassette from pGMC5-SM-RFP-PFurA-GFP-streptomycin ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... [19,21] Each PCR included 12.5 µL Q5 High Fidelity 2x Master Mix (New England Biolabs), 1.1 µL of either pool 1 or pool 2 10 µM primer master mix ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Primers were purchased from Sigma-Aldrich in cartridge purified quality and used in PCR reactions with the Q5 high fidelity (NEB) or the Platinum SuperFi II polymerase (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The tDNA was generated in a subsequent PCR reaction (Q5 High-Fidelity DNA Polymerase, NEB) and purified using the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCR protocol involved two amplification steps using New England Biolabs (NEB, Ipswich, MA, USA) reagents ...
-
bioRxiv - Genomics 2023Quote: ... The oligo library was amplified by four cycles of PCR using New England Biolabs (NEB) Phusion High-fidelity Master Mix ...
-
bioRxiv - Microbiology 2024Quote: ... qRT-PCR reactions were conducted using the Luna Universal qPCR Master Mix (New England BioLabs) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany). The PCR product was purified and sequencing was done using a gene specific primer (GSP3) ...
-
bioRxiv - Microbiology 2024Quote: ... the pUC19-PRha-YFP-3×FLAG plasmid was inverse amplified by PCR (Q5 polymerase, NEB), omitting the yfp gene ...
-
bioRxiv - Microbiology 2024Quote: ... Clean deletions were verified via PCR using Quick-Load Taq Master Mix (New England Biolabs) or Q5 High Fidelity Master Mix ...
-
bioRxiv - Molecular Biology 2024Quote: ... Conditional gene deletion was assessed by PCR amplification of genomic DNA using Taq polymerase (NEB) and oligonucleotides SMD357/8 flanking the TbGT8 locus ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplicons (approximately 3.4 kb) were gel purified using Monarch DNA gel extraction kit (NEB). Library construction ...
-
bioRxiv - Molecular Biology 2023Quote: ... A single round of PCR was then performed using Q5 high fidelity DNA polymerase (NEB) with exon-specific primers appended with Illumina forward adapter sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... was followed by PCR amplification using Phusion high-fidelity DNA polymerase (New England Biolabs; M0530S) for 15 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) with P5 primer (AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNAGGGCGGCAAGATCGCCG TG ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids below 10kb in size were constructed through PCRs and subsequent Hifi assembly (NEB E2621S), according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Each gene was PCR amplified from the plasmids using Q5 polymerase (New England Biolabs; NEB) with the primers 5’-GAAGTGCCATTCCGCCTGACC and 5’-CACTGAGCCTCCACCTAGCC ...
-
bioRxiv - Microbiology 2024Quote: ... Each gene was PCR amplified from the plasmids using Q5 polymerase (New England Biolabs; NEB) with the primers 5’-GAAGTGCCATTCCGCCTGACC and 5’-CACTGAGCCTCCACCTAGCC ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were purified with enzymes ExoI and rSAP (New England Biolabs, Ipswich, MA, USA), Sanger sequenced (Macrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Purified PCR fragments were assembled with the corresponding plasmid backbones by HiFi cloning (NEB; E2621L). Subsequently the assembly mix was transformed by electro transformation into E ...
-
bioRxiv - Microbiology 2024Quote: ... Clones were genotyped with outside-outside colony PCR with NEB OneTaq (New England Biolabs (NEB), Product No ...
-
bioRxiv - Microbiology 2024Quote: ... Clones were genotyped with outside-outside colony PCR with NEB OneTaq (New England Biolabs (NEB), Product No ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products and the respective antibiotic resistance gene were used for Gibson assembly (NEB, USA) (38) ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...
-
bioRxiv - Cell Biology 2024Quote: ... and was assembled with the PCR fragments in NEBuilder® HiFi DNA assembly reaction (NEB) and transformed into DH5α E ...
-
bioRxiv - Cancer Biology 2024Quote: ... Twist Bioscience) followed by PCR amplification using NEBNext HiFidelity 2X Master Mix (New England BioLabs) with Fwd Primer (GTAACTTGAAAGTATTTCGATTTCTTG- GCTTTATATATCTTGTGGAAAGGACGAAACACC ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...