Labshake search
Citations for New England Biolabs :
4751 - 4800 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Single gRNAs were introduced to existing gRNA plasmids by inverse PCR and blunt-end ligation with T4 DNA ligase (NEB). Oligos DAM1-4 and DAM6 were used individually with DAM594 to amplify pCfB3050 making up plasmids pDAM1-4 and pDAM6 ...
-
bioRxiv - Immunology 2022Quote: ... integrated HIV DNA and unspliced HIV RNA was performed by modified nested real-time PCR assay using Taq DNA polymerase (BioLabs) in the first PCR and TaqMax Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Cell Biology 2022Quote: Template DNA for producing DIG-labelled RNA probes were obtained by PCR by using Q5 High-Fidelity DNA polymerase (M0491S, New England Biolabs) with the primers listed in Table S2 ...
-
bioRxiv - Neuroscience 2021Quote: ... of PCR amplicon was used for NGS library preparation with the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (NEB) for samples from library #1 and the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2021Quote: ... by PCR (see 276 bp 5C2 and primer sequences below) using OneTaq Hot Start 2X Master Mix (New England Biolabs). The DNA was purified using the PCR clean-up kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Microbiology 2021Quote: ... The repair templates used for the introduction of the C-terminal tags (YFP and SNAP) were amplified by PCR (Q5 polymerase, New England Biolabs) from template plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2021Quote: A 2018 bp region of the Nicotiana tabacum Petit Havana plastid DNA containing the coding sequence for the N-termini of ATPβ and RbcL was amplified by PCR and inserted into cloning vector pMCS5 (MoBiTec) between the PmeI and PacI restriction sites (NEB) using Gibson assembly (Gibson ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... rRNA-depleted cDNA was used in the PCR using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S) and NEBNext® Multiplex Oligos for Illumina® (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: A 3 µL volume of parasite culture or 10 ng of plasmid was used in 25 µL PCR reactions with Phusion High-Fidelity DNA polymerase (NEB). To confirm pMG74PfAUBL insertion into the 3’ UTR of PfAUBL ...
-
bioRxiv - Molecular Biology 2021Quote: ... A volume of 3.5 μl of the Cre reaction was then used for PCR amplification using the high-fidelity enzyme Q5 (NEB, M0530L) as described above.
-
bioRxiv - Microbiology 2020Quote: ... the primers BT_1927_XbaI-DR and BT_1927_SalI-UF were used to amplify the BT1927-ON and BT1927-OFF promoters from the previously-constructed BT1927-ON and BT1927-OFF strains35 via colony PCR using Q5 High Fidelity DNA polymerase (New England Biolabs). Candidate Δcps BT1927-ON and Δcps BT1927-OFF mutants were screened and confirmed by PCR using the primer pair BT1927_Diagnostic_R and BT1927_Diagnostic_F and confirmed by Sanger sequencing using these diagnostic primers ...
-
bioRxiv - Microbiology 2020Quote: ... nahA encoding sequence was PCR amplified and incorporated into pE-SUMO vector by Golden Gate assembly method (New England BioLabs), and into pVL847 (His-MBP-tag overexpression vector ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting PCR fragment was gel-purified and assembled with the gBlocks fragment using a 2x Gibson master mix (NEB). Gibson assembly was possible due to a 23 bp sequence shared between the PCR fragment and the gBlocks fragment ...
-
bioRxiv - Microbiology 2021Quote: ... The mepH and mepS genes were independently amplified by PCR and cloned in frame with dsbC into pETMM82 using NEBuilder HiFi DNA assembly (New England Biolabs). The fusion proteins comprised the DsbC chaperone (Firczuk and Bochtler ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Microbiology 2022Quote: ... Integration of the constructs in the correct loci and absence of the WT loci were then confirmed by PCR using the Phusion DNA Polymerase (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of cell lysate was used as template for a 25 μL PCR reaction using Taq DNA Polymerase with ThermoPol Buffer (NEB). For each mutant ...
-
bioRxiv - Microbiology 2022Quote: ... All primers and synthesized DNA sequences were purchased from Eurofins Genomics and all PCR reactions were performed using Q5 High-Fidelity (New England Biolabs). Stable CRISPR KHNYN HeLa cells expressing CRISPR-resistant KHNYN-GFP ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Both the vector backbone and segregating lacZ promoter variants were PCR amplified using Phusion High-Fidelity DNA polymerase with HF buffer (New England Biolabs). For promoter PCR amplification ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...
-
bioRxiv - Immunology 2022Quote: ... then the PCR product was digested and ligated into SalI + XhoI digested pMSCV-neo vector with Quick Ligase (NEB, M2200L).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Amplifications were performed in an Applied Biosystems 7500 Fast Real-Time PCR System using the Luna Universal Probe Mix (NEB). We evaluated the performance of the qPCR primers and probes using a DNA concentration gradient spanning 0.1-100.0 ng/reaction in single gene reactions as well as in a multiplex reaction ...
-
bioRxiv - Microbiology 2022Quote: ... We amplified the candidate sequences for the genes of interest with PCR using Phusion® High-Fidelity DNA polymerase (NEB) and primers designed for subsequent cloning (Table S4) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... C39S and C50S were introduced with site-directed mutagenesis PCR with high fidelity Phusion DNA Polymerase (New England Biolabs, M0530) using primers described in Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was subcloned into the expression vector pFN31K-Nluc) using the XhoI and EcoRI restriction endonucleases (NEB, USA) and In-Fusion HD Enzyme (Takara ...
-
bioRxiv - Genomics 2022Quote: ... Full-length L1s were then reconstructed by combining PCR-mutation free fragments from different clones using restriction enzymes (New England Biolabs) recognizing the L1 sequence ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... containing unique barcode to identify which region and time point DNA corresponded to were added to the linearized DNA by PCR amplification with Phusion High Fidelity polymerase (New England Biolabs) and HF buffer (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: ... The library genes were ordered from Eurofins Scientific as EXTREmers Long DNA and amplified by PCR for joining with the XWnt8 vector cut by the EcoRI and BamHI enzymes (New England Biolabs, NEB). Each library insert and the cut XWnt8 vector were mixed at 1:2 molar ratio ...
-
bioRxiv - Cancer Biology 2022Quote: ... Illumina indices and adapters for sample multiplexing were added by PCR amplification with Illumina_indX_F and Illumina_indX_R primers using NEBNext® Ultra™ II Q5® Master Mix (NEB, #M0544). Samples were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2022Quote: ... The plasmid for human UBE2C overexpression was made by subcloning the PCR-amplified UBE2C (IDT) fragment into the EcoRI and Mscl (NEB) site of LeGO-iV2.
-
bioRxiv - Cell Biology 2022Quote: ... was fused to an HA-tag at its N-terminus during PCR and cloned into the lentiviral vector pLJM1 linearized with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The murJ locus in the gDNA of the SglPP7-resistant mutants was amplified by PCR using Phusion high-fidelity DNA polymerase (New England Biolabs) with the primers KC230 and KC234 ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mixture was denatured and annealed in a PCR machine and subsequently digested with 1 µL of T7 endonuclease (New England Biolabs) following the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We then ligated Illumina P2 adaptors to the size-selected libraries and amplified P1/P2-adapted fragments with 12 cycles of PCR using Phusion-HF polymerase (New England Biolabs). RAD libraries were then sequenced in a single lane on an Illumina HiSeq 2500 to generate paired-end 250-bp sequence reads ...
-
bioRxiv - Synthetic Biology 2019Quote: 2 μL of the Dynabeads were used as template for the final PCR using barcoded P5 and P7 primers and Q5 HiFi 2× Master Mix (NEB) + SYBR Green ...
-
bioRxiv - Cell Biology 2019Quote: ... and pcDNA4/TO (forward primer 5’ GACACGTGAGAGGGAGTAGAAGCCGCTGATCAGCCTCGACTG 3’ and reverse primer 5’ CAATGGGGCGGAGTTGTTAC 3’) PCR products were assembled using Gibson Assembly (New England Biolabs) [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ligation Test 1 was processed directly to index PCR while product in Ligation Test 2 was digested by 12.5 units of RNase H (NEB, Cat.No.M0297) at 37°C for 20min before index PCR.
-
bioRxiv - Microbiology 2020Quote: ... The rRNA-subtracted circular product is subjected to a final round of PCR amplification with Illumina adaptor primers [17] using Phusion polymerase (NEB). All the libraries were then quantified ...
-
bioRxiv - Plant Biology 2019Quote: Golden Gate entry modules were made by PCR amplification of gene fragments and inserting the purified PCR product into BsaI-digested GreenGate entry vector (Lampropoulos et al., 2013) via restriction-ligation using BsaI (New England Biolabs) or Gibson assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ng of the LMNB1 plasmid construct was subjected to a standard mutagenic PCR reaction with Q5 High Fidelity DNA polymerase (M0491, New England Biolabs) and 25 ng of specific primers ...
-
bioRxiv - Bioengineering 2019Quote: ... the target region was PCR-amplified using primers Deep-F1/R1 with 25 cycles using Q5 High-Fidelity 2X Master Mix (NEB). Second ...
-
bioRxiv - Immunology 2019Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Bioengineering 2019Quote: A plasmid used in this research (Figure 1B) was prepared by combining the vector DNA and the fragments amplified by PCR using Gibson Assembly (New England BioLabs). The vector harbored the URA3 and the leu2-d markers and the 2-m replication origin derived from the pYEX-S1 (Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplification of full-length cDNAs of CG33172 (clone MIP10235 in BDGP) was done using standard PCR techniques using Q5 high fidelity DNA Polymerase (New England BioLabs). Amplification products were cloned between the HindIII and NotI restriction sites of the pET-28a (Novagen ...