Labshake search
Citations for New England Biolabs :
4801 - 4850 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... fusion constructs were generated by PCR amplification of full-length cDNAs of CG7009 available from BDGP (#SD16956) using standard PCR with VENT polymerase (New England BioLabs). Products were cloned between the EcoRI and NotI restriction sites of the pGEX-4T1 (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Vent DNA Polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Vent DNA Polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The T7-gRNA forward primer and the reverse scaffold primer were used in primer extension reaction to synthesized a double stranded DNA fragment by using Q5 High Fidelity-based PCR (New England Biolabs) followed by PCR purification (Qiagen) ...
-
bioRxiv - Pathology 2020Quote: ... DNA was visualized on 2% agarose gel and genotypes were determined based on PCR product length quantified using a DNA ladder (NEB N0556S ...
-
bioRxiv - Immunology 2019Quote: ... The PCR product was used for a linear amplification reaction with plasmid pJV300 (pPL) using Phusion DNA polymerase (New England Biolabs), and the resulting product was digested with DpnI ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR was performed in a final volume of 20 μL: 10 μL of Q5 polymerase master mix (New England Biolabs), 0.5 μL of forward primer 10 uM ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed in a final volume of 50 μL: 25 μL of Q5 polymerase master mix (New England Biolabs), 2.5 μL of the forward primer at 10 μM ...
-
bioRxiv - Developmental Biology 2021Quote: ... One μl of the total cDNA was used for the PCR (20 μl volume) performed with Taq DNA polymerase (New England BioLabs) and primers (Table 2) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All DNA fragments of the genes were amplified by PCR with Phusion® High Fidelity Polymerase (New England Biolabs, USA) and inserted into the vector pCAMBIA330035Su by USER cloning (Nour-Eldin et al. ...
-
bioRxiv - Biochemistry 2019Quote: Site-directed mutagenesis of AvicFP1 was performed by generating two fragments of the FP coding sequence by standard PCR with Phusion polymerase (New England Biolabs) and primers as listed in Supplementary Table S7 ...
-
bioRxiv - Molecular Biology 2020Quote: Linear DNA templates for in vitro transcription were generated from pNB1u or pOO2-GW plasmid by PCR using Phusion High-Fidelity DNA Polymerase (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... The size of libraries was selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 cycles ...
-
bioRxiv - Neuroscience 2020Quote: The constant oligomer and the gene specific oligomer were annealed on a PCR machine and filled in using T4 DNA polymerase (NEB) (Gagnon et al. ...
-
bioRxiv - Microbiology 2021Quote: ... The open reading frame (lacking the putative lipoprotein signal sequence) of each gene was PCR amplified using Q5 Hot Start Master Mix (New England Biolabs). Each PCR fragment ...
-
bioRxiv - Microbiology 2021Quote: crRNA and target RNA were transcribed in vitro from PCR-generated dsDNA template using T7 RNA polymerase (New England Biolabs) according to manufacturer recommendations and was purified by electrophoresis in 10% polyacrylamide 6M urea gels ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The ade2::TdFBA1 locus from each transformant was amplified by PCR with a high-fidelity polymerase (New England Biolabs, M0492S) and Sanger sequenced ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR amplification was performed in an Eppendorf 2720 Thermal Cycler with either Q5 High-Fidelity DNA Polymerase (New England Biolabs) or GoTaq DNA polymerases (Progema ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: DNA encoding each trigger RNA used in experiments was either amplified from cloned plasmid or from genomic DNA of specified species of bacteria by PCR with Q5 DNA polymerase (New England Biolabs). Primers were designed to create linear DNA with a T7 promoter as well as additional protective sequences on the 5’ and 3’ ends of linear template ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... The target regions were amplified by PCR with either Taq-HP DNA Polymerase (Biospecifika Novosibirsk, Russia) or LongAmp Taq DNA Polymerase (NEB) (primers sequences could be found in electronic supplementary material Table S3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR amplifications were carried out using a DNA polymerase (Phusion High-Fidelity DNA Polymerase; New England Biolabs, Hitchin, UK). The DNA fragments were then purified with a NucleoSpin Gel and PCR Clean-Up Kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2020Quote: ... It was then amplified by PCR and the products were inserted into vector pMAL-p2X (New England Biolabs, Ipswich, Massachusetts). After transformation of E ...
-
bioRxiv - Microbiology 2021Quote: ... Roughly 1/10 of the resulting volume was used as template for a two-step PCR amplification with Phusion High-Fidelity DNA Polymerase (New England Biolabs) per the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... They were constructed by amplifying appropriate DNA fragments by PCR and assembling them using the Gibson Assembly method (New England Biolabs). pRS315-NOP1pro-GFP1-10-mCherry-PUS1 and pRS315-NOP1pro-GFP1-10-mCherry-SCS2TM were generated using PCR products amplified from Addgene plasmids #86413 and #86419 and Addgene plasmids #86416 and #86419 ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Developmental Biology 2019Quote: ... Genomic PCR from single flies was prepared and tested for CRISPR/Cas9 induced mutations using the T7 endo I (BioLabs) assay or by PCR using primers that bind in proximity to the guide RNA targeting site ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Integration of the sequences and removal of sacB gene was confirmed by colony PCR (SI Fig 2) with OneTaq Hot Start Quick-Load 2X Master Mix with GC buffer (New England BioLabs) using a Touchdown thermocycling protocol with an annealing temperature ranging from 72-62°C ...
-
bioRxiv - Synthetic Biology 2019Quote: Plasmid cloning was performed using standard molecular biology techniques of PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... primers used are listed in Supplementary Table 5 and PCR was performed by standard procedures using Phusion high fidelity DNA polymerase (NEB). Gene deletion of sll1951 was performed by amplifying an upstream 966bp fragment in the N-terminal region of sll1951 using primers Sll1951leftfor and Sll1951leftrev and a 954bp downstream fragment in the N-terminal region of sll1951 using primers Sll1951rightfor and Sll1951rightrev ...
-
bioRxiv - Cell Biology 2021Quote: ... the inserts obtained by PCR were digested with BglII and NotI and ligated into a pJK148 vector with a T4 DNA ligase (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... the 1.7-kb upstream and downstream regions of the xopL or xopQ gene were PCR amplified using Xcv 85-10 genomic DNA as template and cloned into pLVC18 linearized with EcoRI (New England Biolabs) using Gibson assembly ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 μL of purified PCR products are used in a 40 μL IVT reaction using HiScribe T7 polymerase (NEB #E2040S) and containing 5 mM each NTPs (NEB # N0466S) ...
-
bioRxiv - Genetics 2019Quote: Linkers to provide homology between terminal assembly fragments and the vector backbone were produced by two- or three-piece fusion PCR using Phusion polymerase as per the manufacturer’s instructions (NEB, M0530). The left linker fragment for the first assembly step encoded 250 bp of the vector and 250 bp of the left-most assembly fragment ...
-
bioRxiv - Cell Biology 2019Quote: ... The PfBiP-Ty1-KDEL-KDEL PCR was cloned into the pCEN-DHOD vector cut with Nhe1 and BglII (New England Biolabs) using the IN-Fusion HD EcoDry Cloning Kit (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... Complementary overlapping sequences were added to the 5-prime end of primers to allow for accurate fusion of all PCR products into PmeI-linearized pMTL-SC7215 vector using Gibson Assembly Master Mix (New England BioLabs). The resulting plasmids were then conjugated into C ...
-
bioRxiv - Biochemistry 2019Quote: ... The digested PCR product was circularized by T4 DNA ligase in a total volume of 500 μL 1x T4 DNA Ligase Reaction Buffer containing 100 μL digested PCR product and 10 kU T4 DNA Ligase (NEB). The reaction was incubated overnight at 16°C and purified by ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids were linearized using two REs (Figure 1) and PCR-amplified parts were assembled into the linear vectors using the NEBuilder HiFi DNA Assembly Master Mix (NEB) for 1h at 50°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... to allow triple ligation of the three PCR products into a pBluescript SK(+) vector using the Gibson Assembly Master Mix (NEB). PAM sites were mutagenized (indicated in bold below ...
-
bioRxiv - Cell Biology 2019Quote: ... The homology donor vectors were constructed by PCR amplifying the template plasmid pLJ851 using Q5 DNA polymerase (New England Biolabs) with 110-base oligonucleotides using a 80-base homology sequence to the N terminal region of the SENP6 gene ...
-
bioRxiv - Microbiology 2019Quote: ... Tubes were centrifuged at 8000 xg for 30 sec and supernatants were used for 16S rRNA gene PCR amplification with Phusion High-Fidelity DNA Polymerase (New England Biolabs) in a 20 μL reaction according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... a multiplex tiling PCR was attempted using the previously published YFV primer scheme and 30 cycles of PCR using Q5 High-Fidelity DNA polymerase (NEB) as previously described (20) ...
-
bioRxiv - Biophysics 2019Quote: ... This fragment was PCR-amplified with the oligonucleotides 89.F lambda 40002 XhoI and 90.R lambda 45263 ApaI using Lambda DNA (NEB) as a template ...
-
bioRxiv - Genomics 2021Quote: ... and libraries were amplified by adding 10 μL DNA to 25 μL of NEBNext HiFi 2x PCR mix (New England Biolabs) and 2.5 μL of 25 μM each of Ad1 and Ad2 primers using 11 PCR cycles ...