Labshake search
Citations for New England Biolabs :
4851 - 4900 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... for 1 hour at 60°C and the lysate was then used as a template for PCR with Q5 Hot Start High-Fidelity DNA Polymerase (NEB). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genetics 2021Quote: ... To assess library composition by deep-sequencing a PCR reaction was carried out to add illumina adaptors by using the Phusion High Fidelity DNA Polymerase (NEB), with an annealing temperature of 60°C and 14 cycles (OG125/OG126) ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Genetics 2020Quote: ... The 307 bp 3’UTR was then amplified from the same WT adult genomic DNA by PCR using Phusion High Fidelity Master Mix (NEB) and primers ...
-
bioRxiv - Genetics 2020Quote: ... All gene amplification reactions were performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs). To analyze the non-drive allele ...
-
bioRxiv - Genetics 2020Quote: ... including protospacer sequences were amplified by PCR to create homology arms and cloned into lentiCRISPR v2 FE Puro backbone through NEBuilder HiFi DNA assembly (NEB). Protospacer sequences used are listed below:
-
bioRxiv - Genetics 2020Quote: ... was PCR-amplified with the LHAdGao23fw and LHAdGao23rev primers from genomic DNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs), producing 1060bp PCR product ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Combinations of indexed Ion Torrent primers were used to amplify barcodes in the library for each time-point (Figure S5 D) using Phusion High-Fidelity PCR (New England BioLabs). To avoid sampling bias during PCR amplification ...
-
bioRxiv - Genetics 2021Quote: ... We then PCR amplified enhancers and promoters separately from the same array using Q5 high-fidelity DNA polymerase (NEB M0492). We amplified enhancers in four 50uL PCR reactions (98°C for 30 seconds ...
-
bioRxiv - Physiology 2021Quote: ... the coding sequence of Fth1 was PCR-amplified (using ProtoScript II Reaction/Enzyme Mix by New England BioLabs, Ipswich, USA).
-
bioRxiv - Biochemistry 2020Quote: DNA templates for in vitro transcription were amplified by PCR using custom DNA primers (IDT) and Phusion Hot Start polymerase (New England BioLabs). 2.5 mL transcription reactions were assembled using 1000 µL PCR reactions as template (∼0.2 µM template DNA) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was then digested by DpnI and subsequently phosphorylated and ligated using T4 PNK and T4 ligase (NEB) before transformation of E ...
-
bioRxiv - Developmental Biology 2021Quote: ssRNA was transcribed directly from the PCR amplicon product in a reverse transcription reaction using a HiScribe T7 polymerase (NEB). The DNA template was then removed through treatment with DNase1 ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Amplified guide RNAs were cloned in a 100 μl assembly reaction with 1.0 μg linearized pNTI661 and 1.7 μl guide RNA PCR using 2 × NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L), which was incubated for 1 hour at 50 °C and then purified with a DNA Clean & Concentrator with final elution into 10 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified with Phusion polymerase for 30-36 cycles and resulting PCR products were separated on a standard 1% agarose gel next to a 100 bp ladder (NEB). PCR primers are listed in Supplemental Table 2 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL from both ssDNA and reverse-transcribed RNA samples were used to template PCR amplification using Taq polymerase (NEB). The resulting amplicons were treated with either ClaI or DraI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids pSP64-L3 and pSP64-L3Δ as well as the derivatives carrying the UcUA mutations were used as templates for PCRs (for primers, see Supplemental Table S6) using Q5 DNA polymerase (NEB) to generate SP6 promotor-containing L3pre DNA fragments that end at the position of 3’-cleavage (after bp 198 ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5-eRF3a-F76a was removed from pCI-MS2V5-eRF3a F76a plasmid (a gift from Niels Gebring) by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). To generate pCI-FLAG-GSPT1 ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5 was removed from pCI-MS2V5-eRF3a F76a plasmid and an N-terminal FLAG tag was inserted to the same plasmid by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). The F76a mutation was mutated back to wildtype using In-fusion cloning (Clontech).
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Immunology 2021Quote: ... CH1 PCR amplified fragments were gel-purified and cloned into restriction enzyme digested pFUSE2ss-CLIg-hK by the Gibson assembly (NEB). The pFUSE2ss-HoleHeavy-hG1 possesses three “hole” mutations (T366S ...
-
bioRxiv - Cell Biology 2022Quote: ... RLuc coding sequence flanked by AgeI and PmeI restriction sites was amplified from the vector pFK i389 JcR2a dg (73) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs) using the following primers ...
-
bioRxiv - Biochemistry 2021Quote: ... specific to the 5′ and 3′ RNA adapter sequence (Table 3) and PCR amplified the whole cDNA using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... annealed and phosphorylated as described above or III) PCR amplified from other vectors using Phusion® DNA polymerase (NEB, M0530L) according to manufactures’ protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... are decided by the Ct value from a qPCR reaction (NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) for the specified cDNA concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were carried out in 25ul volume with Q5® Hot Start High-Fidelity 2Χ Master Mix (NEB, USA), according to the routine PCR procedure of Q5 ...
-
bioRxiv - Developmental Biology 2021Quote: A ~5kb genomic sequence containing 2kb promoter and entire genomic region of tes-1 was PCR amplified using Phusion polymerase (NEB). The primers used were ...
-
bioRxiv - Cell Biology 2020Quote: ... The 3xHA epitope coding sequence was PCR-amplified from pFA6a-3xHA-hisMX6 (Longtine et al., 1998) using Q5 DNA polymerase (New England BioLabs) and assembled into pFA6a-FRB-GFP-hisMX6 ...
-
bioRxiv - Cell Biology 2020Quote: ... or the same strain expressing OsTIR1 driven by the gra1-promoter with 50 μL of a PCR product using Q5 polymerase (NEB) with 500 bp homology arms flanking a tag (3xHA or AID-3xFLAG ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA encoding aa 1-862 of mouse ZO-1 was amplified by PCR using KOD-Plus-Ver.2 DNA polymerase and subcloned into pMAL-cRI (New England BioLabs). Expression vectors for MBP-fusion proteins of PDZ1 ...
-
bioRxiv - Cell Biology 2020Quote: ... All prelamin A variants were constructed using mutagenic PCR and assembled using NEBuilder HiFi Assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Bioengineering 2021Quote: ... 2μL of the resulting crude DNA extract was used as the template in a 50-μl PCR with the OneTaq DNA polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The intact pCFD6 vector was used as a template for the production of the three overlapping gRNA-containing inserts by PCR with Phusion Flash polymerase (NEB) using pairs of primers (pCFD6-Dro5A ...
-
bioRxiv - Genetics 2021Quote: All IRA2 allele fragments were PCR amplified from genomic DNA or commercially synthesized DNA using Phusion Hot Start Flex DNA polymerase (NEB). Genomic DNA was isolated using the ten-minute preparation (Hoffman and Winston ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 100 ng of gDNA was used as template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2020Quote: ... 10uL tagmented DNA prepared as described above was used in a 25uL PCR reaction using NEBNext High-Fidelity Master Mix (New England Biolabs) and Nextera XT Dual-Indexed primers (Nextera) ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Microbiology 2020Quote: The quantification of DWV genome copies was performed by SYBR-Green Real-Time Quantitative PCR (qPCR) using Luna Universal qPCR master mix (New England Biolabs), 0.25 μM forward and reverse DWV_qPCR primers and 2 μl of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... Hhex point mutations were introduced by PCR followed by assembly using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). Hhex truncation was introduced by PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... a 417 bp fragment of the gene was amplified by PCR from a pooled CPB midgut cDNA sample using Phusion DNA polymerase (Biolabs) and cloned into L4440gtwy (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfate-treated DNA served as the template in one round (L1-Gf and L1-A) or two nested rounds (H19 and IAP) of PCR with EipMark Hot Start Taq DNA Polymerase (NEB) using the following protocol ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Cancer Biology 2020Quote: ... We engineered the strain using a chimeric URA3::pol2P301R PCR product amplified in two fragments from pRS416-POL2 (Williams et al. 2013) with Phusion polymerase (New England Biolabs) and the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... A new plasmid was then created by ligating the PCR fragment and the linearized pETDuet-1 vector using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... from RNA-seq samples was used as input for PCR amplification with Phusion High-Fidelity DNA polymerase (New England Biolabs) and UPF1 specific primers that flank the regulatory loop sequence (Forward ...