Labshake search
Citations for New England Biolabs :
4701 - 4750 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Purified PCR product was inserted into pAIP backbone using HpaI and EcoRI restriction endonucleases (New England Biolabs; Euroclone, Milan, Italy). Correct cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics).
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was mixed with the different PCR-amplified sensory domains-ORFs containing overlapping ends using the Gibson Assembly method (NEB). AtLEA4-2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Biophysics 2020Quote: ... The construct was amplified by PCR and inserted into pSNAP-tag®(T7)-2 vector (New England Biolabs Inc. #N9181S) with a SNAPf-EGFP-6His cassette ...
-
bioRxiv - Cell Biology 2021Quote: ... Deletion of the residues 561-625 (ΔNES) was done by deletion PCR using Phusion® High-Fidelity DNA Polymerase (NEB), followed by DpnI digestion of the template and transformation into bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was assembled into pFA6a-GFP-his3MX6 (Longtine et al., 1998) digested with SalI and PacI (New England BioLabs) using the Gibson Assembly Master Mix (New England BioLabs).
-
bioRxiv - Cell Biology 2021Quote: ... and 1 μL purified total cDNA (100-200 ng) was used to amplify target genes through high-fidelity PCR (Q5, New England Biolabs). A vector backbone fragment was obtained by PCR amplification from plasmid pcDNA3.1/zeo(+ ...
-
bioRxiv - Cell Biology 2021Quote: The deletion and the position of the deletion on cno locus were verified by PCR (Phusion polymerase, New England Biolabs) using the primers below ...
-
bioRxiv - Cell Biology 2021Quote: ... The extension PCR amplicons have 40 bp of homologous sequences upstream and downstream of RED1 and were amplified with Q5 polymerase (NEB). Haploid cells were transformed by the lithium acetate/ single-stranded carrier DNA/PEG4000 method [70] ...
-
bioRxiv - Genomics 2020Quote: ... Barcode sequences were first amplified by PCR with RM411 and an i5 primer from NEBNext® Multiplex Oligos (NEB #E7600S) for 12 cycles ...
-
bioRxiv - Immunology 2022Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Microbiology 2022Quote: ... Later steps included purification of the PCR products followed by restriction with the restriction enzymes AvrII and NotI (NEB, UK) and ligation with the T4 DNA ligase (Promega ...
-
bioRxiv - Genomics 2022Quote: ... PCR enrichment of adaptor ligated DNA was performed for 9 cycles using the NEBNext Multiplex Oligos for Illumina (NEB #E7600S) kit to add Illumina dual index sequences ...
-
bioRxiv - Cell Biology 2022Quote: ... On both sides 50 bp of homology was added via PCR to generate the repair templates for homologous recombination using Q5 polymerase (NEB). For internal tagging ...
-
bioRxiv - Systems Biology 2022Quote: ... Column-purified PCR products were cloned into the Golden Gate entry vectors via a Golden Gate reaction using BbsI (New England Biolabs). All paired gRNA entry vectors were verified by Sanger sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... or pSIM6 (ampicillin).(69) Recombineering fragments bearing approximately 50 bp length homology arms were generated by PCR amplification (Q5 polymerase, New England Biolabs) of pKD3- or pKD4-based plasmids and transformed into MG1655 pSIM5 or pSIM6 by electroporation ...
-
bioRxiv - Genetics 2022Quote: The open reading frames of SfOatp74D (Gene ID: 118271297, 2109bp) and DmOatp74D (Gene ID: 39954, 2460bp) were PCR amplified using Phusion polymerase (NEB) from cDNA templates of 3rd instar larvae of S ...
-
bioRxiv - Genetics 2022Quote: ... The primers used to amplify the pEIA plasmid were pEIA-Fgibson and pEIA-Rgibson (S2 Table) and the PCR reaction was performed using Phusion polymerase (NEB). The ORF of the puromycin resistance gene was amplified using Phusion polymerase and pEA-PAC as a template and the primer pair used for the PCR reaction were PAC-Fgibson-AscI/PAC-Rgibson-NcoI (S2 Table) ...
-
bioRxiv - Biophysics 2022Quote: ... using 10 ng of purified plasmid as the template for each 25 μl reaction and 25 PCR cycles with the Q5 Master Mix (New England Biolabs). Amplicons from the clarified culture supernatant (“SUP” ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng DNA was used as input in a first round of PCR (25–27 cycles, Q5 hot start high-fidelity DNA polymerase, New England Biolabs) to amplify the genomic loci of interest and attach common overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... the EcoRI to KpnI fragment was subcloned to a temporary plasmid and PCR amplified with Q5 high fidelity DNA polymerase (NEB) using the dCore-BamHI-FW (5’-TTT CTG GAT CCT TGC TGG CCC TGC TGT CCT GCA TC-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... regions flanking each target site were PCR amplified using locus-specific primers bearing tails complementary to the TruSeq Illumina adapters as described previously.13 25-50ng input genomic DNA is PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... A volume of cDNA corresponding to 2.5 ng of the input RNA was subjected to 35 cycles of PCR with the 2 x NEBNext Ultra II Q5 Master Mix (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... and a volume of cDNA corresponding to 5 ng of the input RNA was subjected to 30 cycles of PCR with the 2 x NEBNext Ultra II Q5 Master Mix (NEB).
-
bioRxiv - Molecular Biology 2022Quote: The regions of interest (supplementary Table 1) were PCR amplified (supplementary table 3) from the extracted DNA using Q5 high-fidelity DNA polymerase (NEB). Of the primers used in the PCRs (supplementary table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... and SLC35A1 were amplified using PCR with specific primers and cloned into the pS lentiviral vector [38] using NEBuilder (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... The ravA and viaA genes were PCR amplified from Escherichia coli K-12 MG1655 genomic DNA using Phusion polymerase (Biolabs). All PCR products were purified by DNA cleanup kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 ng of genomic DNA from genome-targeting experiments were PCR amplified with 30-cycles using Q5 High-fidelity DNA Polymerase (NEB) and primers which bind just outside of TS2 or just inside of LE ...
-
bioRxiv - Physiology 2022Quote: ... while an additional step which added 3’ A-overhangs to the slc15a2a purified PCR product was performed using Taq DNA polymerase (New England Biolabs) before cloning into pCR4-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using Q5 High-Fidelity 2X Master Mix (NEB). For PCR-I ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 μl reverse transcription reactions or ∼10 ng genomic DNA were then subjected to PCR amplification by the high-fidelity Phusion polymerase (NEB) in 50 μl reactions using the primer pairs listed in Supplementary Table S1 and the following cycling program ...
-
bioRxiv - Developmental Biology 2022Quote: ... Digested PCR products were then ligated to the digested pcs2+MCS-P2A-sfGFP plasmid using T4 DNA ligase (M0202S, NEB) in a 3:1 insert:backbone ratio ...
-
bioRxiv - Genomics 2022Quote: ... The three primer pairs were pooled in a multiplex PCR reaction using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) in a 25 μL final volume as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... a ~1-1.5Kb fragment that included guide-RNA target sites was PCR amplified using Q5 High-Fidelity DNA Polymerase (NEB; M0491). Primers were designed using the NCBI Primer Blast tool and are documented in the key resources table ...
-
bioRxiv - Genetics 2022Quote: ... the TSS/Promoter region was amplified by PCR using Illumina compatible primers (TE127 and TE111) from 5 ng plasmid using Phusion HF polymerase (NEB). Sequencing results were analyzed using custom Python scripts to quantify the frequency of each 7 nt TSS sequence.
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was gel-purified and assembled into an NdeI-HindIII-cut pET21b using a 2x Gibson master mix (NEB). Gibson assembly was possible owing to a 23-bp sequence shared between the NdeI-and-HindIII cut pET21b backbone and the PCR amplified fragment ...
-
bioRxiv - Genetics 2022Quote: A DNA template for in vitro transcription was generated by PCR using oligos TE122 and TE126 on plasmid pCT-TE2 and Phusion DNA polymerase (NEB) in HF buffer (Table 1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and T492 were created through PCR mutagenesis of an intron-less version of pHC329 using the oligonucleotides (#1-14) and HiFi assembly (NEB) (Fig ...
-
bioRxiv - Biophysics 2022Quote: ... with the (G4S)4-GGS linker was amplified by PCR by adding a linker sequence and inserted into the pGEX-6P vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... Clones identified as edited had the target ends amplified by PCR with high-fidelity Taq polymerase (Pfusion HF; NEB, M030) and sent for Sanger sequencing (Genewiz ...
-
bioRxiv - Developmental Biology 2022Quote: ... The solution was directly used as a template for PCR amplification using Q5® High-Fidelity 2X Master Mix (NEB) (primer pair ...
-
bioRxiv - Cell Biology 2022Quote: ... A dsDNA donor template for homology-directed repair with 1 kb homologies upstream and downstream was generated by PCR amplification from genomic DNA and assembly into pScarlessHD-sfGFP-DsRed by Gibson DNA Assembly (New England Biolabs). A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences by BestGene ...
-
bioRxiv - Microbiology 2022Quote: ... upstream of the predicted operon containing the kaiC gene were amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the EcoRI and HindIII sites of the pPROBE-TT’ [21] ...
-
bioRxiv - Microbiology 2022Quote: ... the 400-600bps flanking the kaiC gene upstream and downstream were amplified by PCR separately using the Phusion DNA polymerase (New England Biolabs) and purified directly from the PCR mix or from an agarose gel (Gel and PCR clean-up kit ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Microbiology 2022Quote: ... We performed PCR amplification of vector and insert fragments with Q5 high-fidelity polymerase (New England Biolabs, Frankfurt/Main, Germany), followed by DpnI restriction enzyme digest when necessary ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR enrichment of adaptor-ligated DNA was conducted with five cycles and NEBNext Multiplex Oligos for Illumina (NEB, USA) for paired-end barcoding ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pJAM3389 and overlapping primer pair 11/12 were used to amplify a linear plasmid by PCR that was DpnI treated to remove template and ligated using a KLD Enzyme Mix (NEB). For deletion of hvo_1043 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Genotyping of all hSTEAP1-KI mice was performed by PCR of 10 ng of tail DNA using the Taq 2X Master Mix (New England Biolabs) and visualization of PCR products by gel electrophoresis on a 2% agarose gel ...