Labshake search
Citations for New England Biolabs :
4901 - 4950 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The pre-gRNA cassette was PCR amplified using Q5® High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) to encode MluI and BamHI digestion sites as described in Supplementary Table S2 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were pooled and treated for 1 hour at 37°C with 250 u /ml of Exonuclease I (NEB). Libraries were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... and ligation with the NotI digested PCR products was performed for 1 hour at room temperature with T4 DNA ligase (NEB). Colonies were screened by restriction digestion for the directional insertion of PCR products and the resulting lentiviral vectors were validated by Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: ... The sgRNAs in each DNA sample were amplified using the two-step PCR method described previously71 using Hot Start Taq Polymerase (New England Biolabs), however in the second PCR the 8bp barcode was incorporated into the reverse as well as forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... A 523bp fragment of ERV-DC7 or ERV-DC16 env genes was then amplified by PCR using One Taq DNA Polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Immunology 2021Quote: ... 5’ loxP site was added upstream of exon 1 using a galK cassette (NCI Frederick) that was PCR amplified with LongAmp Taq DNA polymerase (NEB), followed by recombineering-based gap repair using 5’ and 3’ arms of homology and cloning into PL253 (NCI Frederick ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Cell Biology 2021Quote: ... S.aureus Cas9 was amplified with homologous adaptors from pX601 by PCR for ligation into the pMB950 plasmid digested with NheI and XhoI (New England Biolabs).
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2021Quote: ... beads were resuspended in 25 μl 0.5x TT and on bead PCR for addition of Illumina-specific adapters and 10-bp Unique Dual Indexes (UDIs) using NEBNext 2X High Fidelity PCR MM (NEB) and 25 PCR cycles was performed (Figure 5-table supplement 2) ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR products as well as Borrelia shuttle vector pBSV2-G were digested with XmaI and XbaI and the resulting PCR product and pBSV2-G backbone were ligated together using T4 DNA Ligase (New England Biolabs), followed by subsequent transformation into E ...
-
bioRxiv - Cancer Biology 2022Quote: ... The locus-specific HDR donors were generated by PCR amplification of the MACHETE bicistronic cassette using a high-fidelity DNA polymerase (Herculase II, Agilent or Q5, NEB). PCR fragments were column purified (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... 3.75 μl (corresponding to ~7,500 cells) of lysate was used as a template for PCR amplification with Q5 Hot-Start High Fidelity DNA Polymerase (NEB) and unique primer pairs containing an internal locus-specific region and an outer Illumina-compatible adapter sequence ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was carried out using NEB Q5 High Fidelity 2x Master Mix (New England Biolabs Inc., Ipswich, Massachusetts, USA). The PCR reaction consisted of 2.5 ul each of 10 μM Forward and Reverse Primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ninety-six 12 μl Gibson reactions were performed in 96-well PCR plates using Gibson Assembly Master Mix (NEB E2611L). The Gibson reaction mix was transformed into Mach1 competent cells (4 μl Gibson into 40 μl cells ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... genome-integrated sgRNA sequences were then amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs, Cat# M5044L), with primers v2.1-F1-5’ GAGGGCCTATTTCCCATGATTC 3’ and v2.1-R1-5’ GTTGCGAAAAAGAACGTTCACGG 3’ ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng of each gel-purified PCR products (total of 19) were mixed and digested with BsmBI restriction enzyme (NEB) for 2 h at 55 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... PDGFRβ DNA inserts containing the desired mutations were generated by PCR amplification using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) and subcloned into pLenti CMV Hygro DEST for cellular studies ...
-
bioRxiv - Biochemistry 2022Quote: ... KIT DNA inserts containing the desired mutations were generated by PCR amplification using the Phusion High-Fidelity DNA Polymerase (New England Biolabs). The inserts were subcloned into either pFastBac 1 vector for structural studies or pBABE-puro vector for cell-based studies ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 244 bp portion of APOE was amplified using standard PCR protocols and digested simultaneously with AflIII (R0541) and HaeII (R0107) restriction enzymes (New England Biolabs) for at least two hours at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL supernatant in a total reaction volume of 20 μL was used as template and PCR was performed using Q5 polymerase (NEB). Primers are listed in Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: PCR products were amplified from the specified genomic DNA samples with Q5 High-Fidelity 2X Master Mix (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: The DNA templates for the different RNA designs were produced by PCR amplification using Phusion High-Fidelity DNA polymerase (NEB) of double stranded gene fragments (gBlocks ...
-
bioRxiv - Bioengineering 2022Quote: pGRNA-sacB-endA was cloned by PCR-amplification of pGRNA-sacB-ccdB using primers 542 and 543 and subsequent circularization of the PCR product by Gibson assembly (New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... pGRNA-galK was linearized by PCR using primers 95 and 391 and assembled with the sacB-fragment by Gibson assembly (New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA samples were amplified with PCR using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs M0494). Primer pairs for all sequences are listed in Table S3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and containing the sequence DuxblExon 5-iRFP702-Duxbl3’UTR after amplifying the corresponding sequences by PCR followed by Gibson assembly (New England Biolabs) (Supplementary Table 8) ...
-
bioRxiv - Developmental Biology 2022Quote: ... musculus was cloned into the pOPIN expression vector using the SLIC method and Phusion Flash High-Fidelity PCR Master Mix (Finnzymes/New England Biolabs). SLIC reactions were then transformed into One Shot™ OmniMAC™ 2 T1® Chemically Competent E ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5ml of the cleaned transposed DNA was used for library amplification (12 cycles) using the NEBNext HiFi 2X PCR Master Mix (New England BioLabs) and previously designed ATAC-seq barcoded primers (Supplemental Table 4 ...
-
bioRxiv - Cell Biology 2022Quote: ... the DNA template was amplified by PCR using Phusion High-Fidelity DNA polymerase and Phusion GC Buffer (New England Biolabs). The PCR product was purified using the DNA Clean & Concentrator-25 kit (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... pDRF1-GW eCFP was made by performing a PCR with KOD One™ PCR Master Mix on AKAR3-EV with FW primer 5′-ATGCTAGCATGGTGAGCAAGGGCG-3′ and RV primer 5′-TAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCG −3′ after which the PCR product and pDRF1-GW were digested using NheI-HF and NotI-HF (New England Biolabs). Finally ...
-
bioRxiv - Genomics 2022Quote: ... 8µl of purified template was used for enrichment and Illumina indexing by PCR using Q5 hot start DNA polymerase (New England Biolabs) (PCR conditions ...
-
bioRxiv - Genetics 2022Quote: ... 1 μL of PCR product was then used in a 20 μL digest reaction with AatII restriction enzyme and CutSmart buffer (NEB). Digestion products were separated on 0.8% agarose gels made with 0.5X TBE ...
-
bioRxiv - Genetics 2022Quote: Genotyping samples of kcnh6a editants submitted to Sanger sequencing (Eurofins Genomics) were PCR amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and locus-specific primers (kcnh6a_fwd 5’-GCTTTGCAAGGTATAGAGCACAG-3’ and kcnh6a_rev 5’-AACGTTGCCAAAACCCACAC-3’ ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... All single-codon substitutions were generated by inverse PCR with Phusion High Fidelity polymerase in HF Buffer (New England Biolabs) using degenerative codon NNN targeted to each codon of the rnc gene ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 40bp downstream) were PCR-amplified from the PN16 (IncI2) plasmid using Q5® High-Fidelity DNA Polymerase (New England BioLabs). The amplified fragment was cloned into pSEVA121 using the NEBuilder® HiFi DNA Assembly kit (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Plant Biology 2022Quote: ... Individual clones were selected and confirmed via colony PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) with primers 1BF and 8R which were designed to amplify the coiled coil and NB-ARC domain coding sequences of MRI-R1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... aeruginosa AZPAE12409 was inserted into pBL1MBPG2L4 RT-8XHis by PCR amplifying a 658-bp region of genomic DNA containing the Direct Repeats with Gibson forward and reverse primers that append flanking KpnI sites and inserting the KpnI-digested PCR product into the KpnI site of pBL1-MBPG2L4 RT-8XHis by using NEBuilder HiFi DNA Assembly (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... The thyA gene region was amplified from the genomic DNA (5 ng) with Phusion High-Fidelity PCR Master Mix (New England Biolabs) using 200 nM of thyA forward and reverse primers that give amplicons of 750 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was done with 1-2 ng of plasmid and 200 nM of each primer in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with pre-denaturation at 98°C for 5 sec followed by 12 cycles of 98°C for 5 sec ...