Labshake search
Citations for New England Biolabs :
4651 - 4700 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... difficile strain 630 genomic DNA and purified PCR products were directly cloned into the PmeI site of pMSR vector using NEBuilder HiFi DNA Assembly (New England Biolabs). All pMSR-derived plasmids were initially transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids to express Flag-tagged and HA-tagged proteins were created by changing the Myc-coding sequence in pCMV-Myc expression plasmids to intended tag-coding sequence using inverse PCR and NE Builder HiFi Assembly (New England BioLabs), respectively.
-
bioRxiv - Biophysics 2020Quote: ... along with the purified PCR fragment was digested with EcoRI and XbaI then ligated together with T4 DNA ligase (M0202, New England Biolabs). pENTR1a-3xNLS-mScarlet-I was then recombined using Gateway LR Clonase II (11791 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μL of the diluted PCR product was amplified in a 20 μL barcoding reaction that included 1X NEBNext Phusion Master (NEB) and 4 μL of the Fluidigm Access Array barcoding primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Cell Biology 2021Quote: ... CK1γ3 kinase dead mutants were generated using PCR mutagenesis and cloned into pDONR223 digested with BsrGI using Gibson Assembly Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were constructed and amplified using 1.25 μ Nextera index primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... The guide RNA target site was amplified from transfected cells and analyzed by T7 Endonuclease I digestion of re-annealed PCR products (New England Biolabs). The guide RNA eventually selected for genome editing in embryos was Bahd1-sg47B (protospacer sequence 5’-GCCTGTAATACCACAGG −3’) ...
-
bioRxiv - Biochemistry 2020Quote: ... the truncated CNNM2 PCR products were cloned into the pCINE-IRES-GFP vector by digestion with restriction enzymes NheI (New England Biolabs) and XhoI (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... The full-length SpG was assembled using the overlapping-extension PCR-based method with the high-fidelity DNA polymerase Phusion (NEB) and the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... 17 μl of the PCR reaction were mixed with 2 μl of CutSmart Buffer and 1 μl of AvaI (NEB) for a final volume of 20 μl ...
-
bioRxiv - Systems Biology 2020Quote: ... Appropriate restriction sites were either included in custom synthesized oligonucleotides (IDT) or introduced by PCR with Q5 High-Fidelity Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutation of Cys324 to alanine was achieved by site directed mutagenesis by inverse PCR using Q5 high fidelity DNA polymerase (New England, BioLabs), pET28-PnpA as template and primers (5’-GCCTCTGGTTTATTAAAAAGGTTATTCAGC-’3 and 5’-ATCATTATTGAAATCCATTCCCCC-’3) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The double-stranded template was produced by annealing the strands and filling in the single-stranded regions with Phusion HF PCR Master Mix (NEB) by cycling between the melting temperature of the strands and 72°C twenty times ...
-
bioRxiv - Neuroscience 2020Quote: ... and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB) and primers (GAATTC(EcoRI)/GAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCC and GGATCC(BamHI)/AGCTTTAATAGTGTGCAGGGTCAGTCAG) ...
-
bioRxiv - Microbiology 2020Quote: ... After bead purification half of the DNA elute was used for a 50-µl PCR reaction containing the NEBNext High-Fidelity 2x Master Mix (NEB), 25 pmol ...
-
bioRxiv - Plant Biology 2020Quote: The cDNA encoding the full length AtHMA4 protein or the cDNA encoding the 473 amino acid AtHMA4 C-terminal domain was amplified from previously generated AtHMA4 cDNA plasmids (Mills et al., 2010) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs). The primers AtHMA4FL-F (5′-ACTGGATCCCTCTCAACCTTTATCTGAT-3′ ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed 4 PCRs per pool from cDNA and gDNA respectively using the Q5 High Fidelity 2X Master Mix (New England Biolabs), then pooled the PCRs and purified them ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2020Quote: Template DNA was amplified by PCR using custom DNA primers (Table S3) and recombinant Phusion Hot Start polymerase (New England Biolabs). In vitro transcription was carried out in a volume of 2.5 mL comprising 1.0 mL of PCR reaction as template ...
-
bioRxiv - Microbiology 2020Quote: ... Obtained PCR product (531 bp) and pRSF-NT vector were digested with NcoI-HF and HindIII-HF (New England BioLabs) and ligated using T4 DNA ligase (New England BioLabs) ...
-
bioRxiv - Plant Biology 2020Quote: ... a 6.5-kbp promoter region was incorporated into pDONRP4-P1R by assembling four PCR fragments with the Gibson Assembly technology (New England BioLabs). The protocol for the Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was ligated to a low-copy plasmid vector pWSK29 (BamHI/Sall) by Gibson assembly (New England Biolabs). Similarly ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products were inserted into pSN054 cut with FseI and I-SceI respectively via Gibson Assembly (New England Biolabs). The recodonized Pf3D7_1437000 gene was synthesized by GENEWIZ (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... Regions of 16S rDNA gene were amplified by PCR from extracted DNA with the Q5 high-fidelity DNA polymerase (New England BioLabs) using the universal primers 926F ...
-
bioRxiv - Microbiology 2021Quote: ... The Transposon-gDNA junctions were prepared for sequencing by PCR addition of Illumina adapters using the NEBNext Multiplex Oligos for Illumina (New England Biolabs). However ...
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Microbiology 2021Quote: ... a 1kb fragment up- and downstream of the target gene was amplified via PCR and cloned into the pMQ30 plasmid using Gibson cloning (NEB) and transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin cassette bookended with FRT sites from plasmid pKD4 with 60-bp homology to the upstream and downstream region of mgrB was PCR amplified using high fidelity Q5 polymerase (New England BioLabs [NEB]). The purified PCR product was then electroporated into the target strain (AZ63 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR to amplify the barcode region was performed in 2ul of boiled cells using Phusion DNA polymerase (New England Biolabs). The presence of the correct PCR product was verified on an agarose gel and samples were pooled ...
-
bioRxiv - Neuroscience 2020Quote: ... each round of evolution also included a library created by gene-shuffling the selected clones using the staggered extension PCR method [20] and Taq polymerase (New England Biolabs). The amplified DNA fragments were inserted into the constitutive bacterial expression vector pNCS (gift from Nathan Shaner ...
-
bioRxiv - Microbiology 2021Quote: ... Restriction enzyme-cut pTOX3 was incubated with purified AB and CD PCR products along with a half-reaction of HiFi DNA Assembly Master Mix (NEB) according to manufacturer’s directions ...
-
bioRxiv - Genomics 2021Quote: ... and used to prepare libraries using the Nextera XT Dual-Indexed primer system (Nextera) and NEBNext High-Fidelity PCR Master Mix (New England Biolabs). Libraries were sequenced by the UCSD Institute for Genomic Medicine on an Illumina HiSeq 4000 using paired end reads of 100bp.
-
bioRxiv - Molecular Biology 2020Quote: ... The vector and the PCR insert were used to prepare 4 ligation reactions by mixing with T4 Ligase (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... DNA amplicons for HA and PA gene segments with partial sequencing adapters were generated via PCR amplification of cDNA using the Phusion High-Fidelity DNA Polymerase (New England BioLabs) and gene segment specific primers (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μl of DNA extract was added to 25 μl of LongAmp Taq DNA polymerase PCR reaction mix (Cat # = M0323, New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Molecular Biology 2020Quote: PCR was carried out with TIDE or amplicon sequencing primers as shown in the Supplementary Table using High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using the DNA Clean & Concentrator-100 (Zymo ...
-
bioRxiv - Microbiology 2020Quote: ... Constructs with single amino acid substitutions in SctD or SctF were created by overlapping PCR using Phusion polymerase (New England Biolabs), and expressed from an arabinose controlled expression vector (pBAD).
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... 10 mg cell samples were homogenized and lysed mechanically by micropestle and subjected to PCR with Taq Polymerase (NEB, USA). The following primers were used ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2019Quote: ... RRL→ARL or RRL→AAA mutated complementation plasmids were generated using overlap extension PCR using primers harboring the mutation and cloning the resultant products into pX-V5 using Gibson Assembly (NEB).
-
bioRxiv - Microbiology 2020Quote: ... and the amplified product was cloned into the PCR-generated pCjSpLe94(29) by NEBuilder HiFi DNA Assembly cloning (New England BioLabs), generating pNKLiG1 ...
-
bioRxiv - Biochemistry 2021Quote: All plasmids were constructed by Gibson Assembly from PCR products generated using Q5 Hot Start DNA Polymerase (New England Biolabs) or Phusion Polymerase (generated in-house) ...