Labshake search
Citations for New England Biolabs :
4301 - 4350 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 15 µL of labeling mix (4 µL 10X ThermoPol Reaction buffer (NEB, B9004S), 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP ...
-
bioRxiv - Microbiology 2021Quote: All bacterial two-hybrid plasmids were constructed using the Gibson assembly mix (NEB) or the Hifi DNA assembly mix (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... and PODXL2 were mixed with Protein Deglycosylation Mix II (New England Biolabs, #P6044S). The suggested protocol by the supplier was used with the exception of incubation time (the proteins were only incubated at RT for 20 h).
-
bioRxiv - Microbiology 2019Quote: ... PCR products were assembled into an intact plasmid using NEBuilder HiFi mix (NEB). Plasmids were transformed into E ...
-
bioRxiv - Genomics 2019Quote: ... The DNA was repaired using the NEBNext FFPE Repair Mix (New England Biolabs), end-repaired and adenylated with the NEBNext Ultra II End Repair and A-Tailing Module (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and 3 µl of NEBNext Ultra II End Prep Enzyme Mix (E7545L, NEB) were mixed gently in 1.5 ml Eppendorf tube ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCRs in this section were carried out using Q5 PCR Mix (NEB), 5 ng template and appropriate primers in 20 μl reactions ...
-
bioRxiv - Genomics 2021Quote: ... then 25μL of the end-repair mix (3.5X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 15μL of the end-repair mix (1X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 25μL of the end-repair mix (3.5X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 15μL of the end-repair mix (1X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... 115 nL of DpnI mix (1× NEB CutSmart buffer, 0.1 U NEB DpnI) was added ...
-
bioRxiv - Genomics 2021Quote: ... 115 nL of DpnI mix (1× NEB CutSmart buffer, 0.1 U NEB DpnI) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... and then digested with 2 μL Nucleoside Digestion Mix (#M0649, New England Biolabs) in a 50 μL reaction incubated at 37 °C overnight ...
-
bioRxiv - Genomics 2021Quote: ... Samples were digested into nucleosides using Nucleoside digestion mix (M0649S, New England Biolabs) following manufacturers protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and end-repair dNTP mix (40uM dATP, 4uM dGTP, and 4uM dCTP; NEB) totaling 2 µL per reaction were added to perform end-repair and dA-tailing ...
-
bioRxiv - Microbiology 2021Quote: ... The product was digested using the KLD Enzyme Mix reagents (New England Biolabs) and transformed into DH5-alpha competent cells ...
-
bioRxiv - Genomics 2020Quote: ... The reaction mix included 1 μl of 10x poly(A) polymerase buffer (NEB), 0.1 mM of ATP ...
-
bioRxiv - Microbiology 2020Quote: ... Briefly, DNA was repaired (FFPE DNA Repair Mix, New England BioLabs® (NEB)) ...
-
bioRxiv - Microbiology 2021Quote: ... 5’UTR was obtained using the Template Switching RT Enzyme Mix (NEB #M0466) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... and nucleoside digestion mix were purchased from New England Biolab (NEB, Ipswich, MA). DNase was purchased from Roche (Basel ...
-
bioRxiv - Genomics 2022Quote: ... tagmented samples were incubated in Repair Mix (0.1U Phusion-HF (New England Biolabs), 4U Taq DNA Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... HMW DNA was first repaired with NEBNext FFPE Repair Mix (New England Biolabs) and 3’-adenylated with NEBNext Ultra II End Repair/dA-Tailing Module (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... cross-linked virion samples were deglycosylated using Protein Deglycosylation Mix II (P6044, NEB) under denaturing conditions according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and the products were cloned using NEBuilder HiFi DNA Assembly mix (NEB, E2621). The cloning reaction was transformed into electro-competent cells (NEB C3020 ...
-
bioRxiv - Microbiology 2022Quote: ... and DNA assembly was performed using the NEBuilder HiFi mix (New England Biolabs). B ...
-
bioRxiv - Molecular Biology 2022Quote: ... The linearized plasmids were treated with PreCR Repair Mix (M0309, New England Biolabs) and purified with the Monarch PCR & DNA Cleanup Kit (T1030 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligated DNA was repaired with PreCR Repair Mix (M0309, New England Biolabs) at 37°C for 30 minutes ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: Four hundred nanograms of the amplicon was incubated with KLD Mix (NEB, USA) in a 20ul reaction at room temperature for 30 minutes.
-
bioRxiv - Cell Biology 2024Quote: ... the two fragments were assembled using a Gibson assembly mix (NEB, no. E2611S) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... then incubated overnight with DraI mix (2 U/uL DraI enzyme (NEB, R0129) in 1X CutSmart buffer ...
-
bioRxiv - Genetics 2023Quote: ... Nicks in the DNA were repaired with PreCR Repair Mix (New England Biolabs). Samples were barcoded with the NEBNext Ultra II DNA Library Prep Kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were barcoded using the NEBNext End repair/dA-tailing mix (NEB, E7546) and NEBNext Ultra II Ligation Module (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... PCR product was then directly used for circularization with KLD enzyme mix (NEB) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR mix consists of 2 µL LongAmp Taq DNA Polymerase (NEB, # M0323L), 0.5 µM of each primer (ncec_pcr_fw_v7 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA fragments were repaired with the End-Repair enzyme mix (New England Biolabs). A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... This mix includes 2.5 µL of Template Switching RT Buffer (NEB Catalog# B0466S), 0.5 µL of 25 µM Template Switching Oligo (5 µM final concentration in RT mix ...
-
bioRxiv - Biophysics 2023Quote: ... 163 and 71 using a BsaI-HFv2 golden gate reaction mix (NEB E1601). The intermediate vectors were made using traditional cloning techniques (in details described in Table S1).
-
bioRxiv - Molecular Biology 2023Quote: ... The E919A mutation was introduced using a KLD Enzyme Mix (NEB, no. M0554) with primers CCAGTCCTTACAATCTTCGTC and GTACATCGGGcGATCGTAGCGG (Supplementary file 4) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl NTP buffer mix (1.34 mM final concentration for each NTP, NEB), 2 μl T7 RNA Polymerase Mix (NEB ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was repaired and end-prepped using NEBNext FFPE DNA repair mix (NEB) and the NEBNext Ultra II End Repair/dA-Tailing Module (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by addition of 50 μL of extension mix (1X buffer 2 (NEB), 0.4 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 μl of deoxynucleotide (dNTP) solution mix (40 μM; New England Biolabs, UK), 1 μl of forward primer (10 μM ...
-
bioRxiv - Genomics 2023Quote: ... RCA was performed at 30°C overnight using Phi29 enzyme mix (NEB, M0269L). fluorescent probes hybridization was done at 2X SCC and 10% formamide buffer mix ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA assembly was achieved with the NEBuilder HiFi mix (New England Biolabs). The B ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented by a 2× NEBuilder HiFi DNA assembly enzyme mix (New England Biolabs). Gibson reactions were incubated for one hour at 50°C and then transformed into DH5-alpha competent E ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng/µL injection mix (70 ng/µL 1 kb DNA ladder (NEB), 30 ng/µL plasmid of interest ...
-
bioRxiv - Biochemistry 2024Quote: ... between the SalI and XbaI restriction sites using HiFi DNA Assembly Mix (NEB). Point mutations (K119R ...