Labshake search
Citations for New England Biolabs :
2101 - 2150 of 2232 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... mAmetrine was inserted in place of GFP in both pDawn and pDusk plasmids via PCR and Gibson assembly (NEB HiFi mix). Using the same method ...
-
bioRxiv - Systems Biology 2023Quote: ... 3) the wt bZIP sequences by digesting them out of them original plasmids with BamHI-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted using the NEBuilder HiFi DNA Assembly Master Mix into the pKH011 plasmid digested with NcoI-HF (NEB, Cat# R3193S) and XbaI (NEB ...
-
bioRxiv - Pathology 2023Quote: ... a synthetic gene fragment containing the Spleen-forming focus virus promoter sequence followed by the iRFP670 protein-coding sequence (gBlock; Integrated DNA Technologies, IDT) was assembled with the gel-purified plasmid using the HiFi Assembly Master Mix (NEB, E5520) disrupting nef sequence (Δnef) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gene of the mCherry fluorescent protein was inserted into the pHERD20T plasmid according to the manufacturer’s protocol of NEBuilder® HiFi DNA Assembly kit (New England Biolabs, UK). The resulting plasmid was named pHERDmCh ...
-
bioRxiv - Microbiology 2023Quote: ... Repair template was generated by using oligos P7/P8 to amplify GFP sequence from plasmid pCas9/sgRNA/Bleo with Phusion® High-Fidelity DNA Polymerase (New England Biolabs). ME49Δku8021 was transfected with 100 μg of gRNA and 20 μg of repair template ...
-
bioRxiv - Microbiology 2023Quote: Golden Gate assembly part plasmids were made by cloning the parts into the cloning vector pBTK1001 using BsmBI-v2 (New England Biolabs, USA) (Fig S5 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The Homology-Directed Repair (HDR) template used for gene replacement was assembled into plasmid pBluscript KS-using HiFi assembly (NEB, E2621S). Two independent mutants were obtained based on two different protoplast pools and different sgRNAs (Supplemental Table 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-SopF coding sequence was cloned into the pPB Piggybac plasmid (Vectorbuilder) using the NEB HIFI DNA Assembly Kit (NEB, E2621L).
-
bioRxiv - Cell Biology 2023Quote: Capped mRNAs with poly-A tail were synthesized from linearized pGEMHE plasmids using the HiScribe™ T7 ARCA mRNA Kit (NEB). The mRNA was purified by Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... This fragment was inserted into the pAAV plasmid above using the Gibson Assembly® Master Mix (New England Biolabs, Ipswich, MA). This “base” plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid was linearized by PCR and a gene block introducing 9 alanine point mutations was ordered from IDT and cloned into the linearized plasmid by Gibson assembly (NEB E2611L) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... pPGK1-mCherry was amplified from the mCherry plasmid described in (Tunney et al. 2018) using uracil-containing primers with Q5U polymerase (New England BioLabs, M0515) and inserted into EasyClone plasmid pCfB2226 by USER cloning upstream of the ADH1 terminator with USER Enzyme Mix (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear DNA constructs encoding Dam or eGFP were amplified via PCR from the plasmids pJV302 (Dam) and pJV170 (eGFP) using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S). PCR reactions were treated with 1 μL of DPNI for 3 h at 37°C and purified with Zymo Research’s Clean & Concentrator-5 kit according to the manufacturer’s protocol (Zymo CN# D4004).
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were then introduced into pBBR1-MCS2 plasmid at XhoI and HindIII restriction sites (#R0146 and #R0104; New England Biolabs NEB). We then transformed (thermal shock ...
-
bioRxiv - Microbiology 2024Quote: ... A fragment containing the CRISPR array plus the extra BsrG1 restriction site was cut from the synthesized pUC19 by digestion with DraI and BstZ17I enzymes and cloned into the BsaI-linearized pSTU-1 plasmid using the NEBuilder HiFi cloning kit (New England Biolabs, UK). The plasmid sequence was confirmed by sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Cancer Biology 2023Quote: ... coding sequence was generated from pSBbi-RN-FGF19 plasmid using site directed mutagenesis (Q5® Site-Directed Mutagenesis – New England BioLabs) using the primers FOR 5’-ATCGGGCCTCTGAGGCCATGCGCGACTCGTCGCCCCTCGTGCACTACGGCTGG-3’ and REV 5’ – CGATGGCCTGACAGGCCTTACTTCTCAAAGCTGGGACTCC– 3’.,
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Systems Biology 2024Quote: ... we directly engineered the pre-barcoded pSL51 and pre-barcoded pSL737 plasmid pools using PCR and HiFi in vitro recombinational assembly (NEB reagents) to generate a construct that should express a single methionine start-codon fused to the Gateway attL2/attR2 “scar” sequence (YPAFLYKVV) ...
-
bioRxiv - Microbiology 2024Quote: nfsA and nfsB mutants were constructed by gene inactivation using the pKNOCK suicide plasmid (22) The DNA fragments were amplified with Phusion high-fidelity DNA polymerase (NEB, UK) from E ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Molecular Biology 2024Quote: ... the linear DNA was digested using 28.8 U/μL of plasmid-safe ATP-dependent DNase Exonuclease V (ExoV, RecBCD) (New England Biolabs, MA, USA) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: The pLIC-HA-DHFR-TS (gift from Jeroen Saeij, University of California, Davis) plasmid was treated simultaneously with PacI (NEB #R0547S) and AvrII (NEB #R0174S ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA fragments for construction of the plasmids were obtained through either high-fidelity amplification using Q5 DNA Polymerase (NEB, USA) or restriction enzyme digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... Primers containing the spacer sequence and homology to the rcRNA plasmid backbone were annealed using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids from non-motile isolates with straightened flagella were purified using the NEB monarch DNA mini prep kit (NEB, Ipswich, MA) and sequenced by Sanger sequencing using the primers (5-GGCACGAATTCCGAGCTGACGACCGTTCAG-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... All mutated YFP-CESA6 constructs used the verified YFP-CESA6 plasmid as the template and were obtained by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA) with primers listed in Supplement Table1 ...
-
bioRxiv - Microbiology 2021Quote: ... The reporter was engineered to express the red fluorescent protein mKate2 from the tad/flp promoter by cloning this segment of DNA into plasmid pLL103 through digest by KpnI and SphI restriction enzymes (NEB, Ipswich, MA) to generate pJS2020.1.
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes for Popi-Dfd were synthetized from the plasmid template of Popi-Dfd3’ using T7/T3 RNA polymerase (New England Biolabs, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... The mlrA gene was amplified from the MlrA-expression plasmid pASKA-MlrA (Table EV2) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs, Tokyo, Japan) and the primer set Pure-Niwa-F and Pure-Niwa-R (Table EV3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmids were mixed in equimolar ratio and 20μg of mixed plasmid was subjected to restriction digestion with the enzyme Sau3AI (NEB, Catalog number: R0169) (Isoschizomer of DpnII ...
-
bioRxiv - Genetics 2019Quote: ... were introduced into the flank region of GFP expression cassette in p123 plasmid in HindIII and EcoRV site sequentially by Gibson assembly (New England Biolabs, Ipswich, USA). The resulting plasmid p123-19MM was then linearized by SspI and transformed into SG200 protoplast as described previously (Schulz et al ...
-
bioRxiv - Cell Biology 2019Quote: ... with the mCherry tag from the pET28 mCherry plasmid using NEB Gibson Assembly (Gibson Assembly Master Mix, New England BioLabs, Cat. # E2611S). See Table EV10 for primer sequences.
-
bioRxiv - Synthetic Biology 2019Quote: ... the CggR mutant variant R250A was inserted in the above generated plasmids (replacing the CggR wt) using the NEB Gibson assembly kit (New England Biolabs, MA, US). 5 µl of reaction mix was transformed into chemical competent E ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Synthetic Biology 2021Quote: All the plasmids used in this study were generated by Gibson Assembly using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, E2621L) as per manufactory’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: Ten µg of plasmid GR-306MP_MhTHI4 were digested overnight using 1.5 µl of ScaI-HF® (New England Biolabs, catalog no. R3122) in a total volume of 50 µl ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutant gfp1a and gfp1b were created by inserting a gblcoks containing frame shift mutation sequences at the 5’ end of GFP coding sequence of pGFPGUSPlus (Plasmid #64401 in addgene) using the NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs, Catalog #E5520S). Then ...
-
bioRxiv - Systems Biology 2021Quote: ... and then cloned into the EagI and EcoRI sites of the plasmid pJK03 with multiple 20 microliter ligation reactions (NEB T4 ligase). The libraries were transformed into 5-alpha electrocompetent cells (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genes of interest were cloned into the pLenti CMVTRE3G eGFP Neo (w821-1) plasmid using a Gibson Assembly Master Mix kit (Cat# E2611S, New England Biolabs, Ipswich, MA). pLenti CMV rtTA3 Blast (w756-1 ...
-
bioRxiv - Molecular Biology 2020Quote: The rAAV:HDR:cleaved plasmids were linearized with BspQI restriction enzyme and spacer sequences with compatible overhangs were ligated into 100 ng of plasmid backbone using ElectroLigase® (NEB M0369) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... were used to clone plasmids using a combination of standard molecular cloning techniques and Gibson Assembly (master mix from New England Biolabs, Ipswich, MA). The plasmid pJS167 (45 ...
-
bioRxiv - Cell Biology 2021Quote: ... mutant (GFP-FIP3-I738E-ABD) were engineered from the McCaffrey plasmids GFP-FIP3 and GFP-FIP3I738E using the Q5 Mutagenesis Kit (New England Biolabs, Ipswich, MA) following manufacturer instructions ...
-
bioRxiv - Biophysics 2021Quote: ... a variable 89-bp hairpin stem capped by a (dT)4 tetraloop was ligated to two 1.5-kb double-stranded “handles” made by PCR amplification of sections of the pBR322 plasmid (New England Biolabs, Ipswitch, MA, USA). The left and right handles were respectively modified with 5’ biotin and digoxigenin to facilitate attachment to streptavidin- and anti-digoxigenin antibody-coated beads ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for Spike G614 variant was generated using the pTwist EF1alpha nCoV-2019 S 2xStrep plasmid and the Q5 site-directed mutagenesis kit (New England BioLabs, Evry, France) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Single primer PCR was performed in 2 different tubes for each plasmid using Q5 2X Master Mix (New England Biolabs Cat.No M0492S). After the amplification ...