Labshake search
Citations for New England Biolabs :
1701 - 1750 of 2232 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and subsequently modifying the plasmid to add the HA-tag coding sequence using the Q5 Site-Directed Mutagenesis kit (NEB) or the mEos3.2 coding sequence using InFusion (Clontech) ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... we digested the p416-UbMpro(lib)-B112 plasmid upstream of the N18 sequence and downstream of the Mpro sequence with NotI and SalI enzymes (NEB). The resulting 1800 bp fragment containing the barcoded library was isolated by Blue Pippen selecting for a 1 to 4 kB range ...
-
bioRxiv - Microbiology 2022Quote: ... The D614G spike plasmid was generated by introducing the mutation into the Wuhan reference strain via Q5 site-directed mutagenesis (NEB). The T95I ...
-
bioRxiv - Molecular Biology 2022Quote: ... fluorophores were prepared by PCR amplification from the pTriEx-MLucV plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The proteins were expressed and purified in a similar way to MLucV ...
-
bioRxiv - Developmental Biology 2022Quote: ... Digested PCR products were then ligated to the digested pcs2+MCS-P2A-sfGFP plasmid using T4 DNA ligase (M0202S, NEB) in a 3:1 insert:backbone ratio ...
-
bioRxiv - Genetics 2022Quote: ... the TSS/Promoter region was amplified by PCR using Illumina compatible primers (TE127 and TE111) from 5 ng plasmid using Phusion HF polymerase (NEB). Sequencing results were analyzed using custom Python scripts to quantify the frequency of each 7 nt TSS sequence.
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).
-
bioRxiv - Genetics 2022Quote: A DNA template for in vitro transcription was generated by PCR using oligos TE122 and TE126 on plasmid pCT-TE2 and Phusion DNA polymerase (NEB) in HF buffer (Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: The purified insert was digested with XhoI and NcoI and inserted into the plasmid by ligation with T7 DNA ligase (NEB) following the manufacturer’s instructions to generate the pGL_CXCL8_promoter_Firefly.
-
bioRxiv - Microbiology 2022Quote: ... containing a T7 polymerase promoter flanking either side of the amplicon and directly cloned into a pTOPO plasmid using EcoR1 (NEB). FLuc plasmid was described previously (59 ...
-
bioRxiv - Bioengineering 2022Quote: ... The GC3-optimized NPC1 sequence was encoded in a plasmid (Twist Bioscience) and linearized via double restriction enzyme digestion using BamHI-HF (NEB) and HindIII-HF (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products digested by SphI and HindIII were cloned into pQF50-chl and/or pQF50-Amp plasmids using T4 DNA ligase (NEB) to generate the different pMP plasmids (38 ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pJAM3389 and overlapping primer pair 11/12 were used to amplify a linear plasmid by PCR that was DpnI treated to remove template and ligated using a KLD Enzyme Mix (NEB). For deletion of hvo_1043 ...
-
bioRxiv - Biochemistry 2022Quote: ... Equivalent ZFC4 patient mutations were introduced by subcloning mutations from expression plasmids and incorporation using Gibson assembly (NEBuilder HiFi E2621S, NEB). Plasmids are available upon request.
-
bioRxiv - Bioengineering 2022Quote: ... Annealed oligonucleotides were then ligated into the BbsI restriction sites of pSP-gRNA or our previously described split-intein CBE-containing plasmids 55 using T4 DNA ligase (NEB).
-
bioRxiv - Systems Biology 2022Quote: ... coding sequences and terminators were assembled together into the transcription unit acceptor plasmid (POT1-ccdB) by Golden Gate assembly using Esp3I (NEB); these are low-copy centromeric plasmids with URA3 selection marker ...
-
bioRxiv - Cell Biology 2022Quote: ... Single gRNAs were introduced to existing gRNA plasmids by inverse PCR and blunt-end ligation with T4 DNA ligase (NEB). Oligos DAM1-4 and DAM6 were used individually with DAM594 to amplify pCfB3050 making up plasmids pDAM1-4 and pDAM6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used Addgene Plasmid #48140 as a transient expression vector backbone by removing Cas9 and GFP with EcoRI-AgeI digestion (NEB), and inserting three overlapping gBlock dsDNA fragments for JAK1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gblock was integrated into a Kpn I-Eco RI digested pKLV2-gRNA expression lentiviral plasmid by Gibson assembly (NEB), expressing a BE-FLARE gRNA (5’-GCTCATGGGGTGCAGTGCTT-3’).
-
bioRxiv - Cell Biology 2022Quote: ... Mutations in the sgRNA target site of the plasmid were introduced and neomycin was removed using Q5 Site-Directed Mutagenesis Kit (#E0554S, New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: A plasmid was created for each gene of interest (GOI) using the modified pSAG plasmid template and the Q5 Site-Directed Mutagenesis Kit (NEB) by following the manufacturer’s protocol with a few adaptations ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: A 3 µL volume of parasite culture or 10 ng of plasmid was used in 25 µL PCR reactions with Phusion High-Fidelity DNA polymerase (NEB). To confirm pMG74PfAUBL insertion into the 3’ UTR of PfAUBL ...
-
bioRxiv - Molecular Biology 2020Quote: The region including 5’UTR and CDS of Thor was cloned into pMT-Linker-ADARcd-E488Q-V5 plasmid (100aa flexible linker) to make pMT-Thor-Linker-hyperTRIBE construct using Gibson Assembly (NEB) (Xu et al ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding sequence of GluN2A and GluN2B point mutations for sgRNA resistant plasmid (GluN2A: AGCCACGACGTGACAGAACGCGAACTT to AGTCACGACGTGACTGAGAGAGAACTT; GluN2B: ATGTCTGACCGGAAGATCCAGGGG to ATGTCTGATCGTAAGATTCAAGGA) were generated by Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... The resulting fragment was cloned into the BamHI-NcoI sites of plasmid pGFP-phleo using the NEBuilder DNA assembly kit (New England Biolabs). In this plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified and ligated to BbsI-digested pDonor_mU6 plasmid (kindly provided by A. Ventura) by using the Gibson Assembly Master Mix (New England Biolabs 174E2611S). The Gibson reaction was then digested with BbsI at 37□°C for 3□hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Mutations identified in EA6 patients were introduced into hEAAT1 plasmid DNA using Q5 site-directed mutagenesis kit (New England Biolabs). Purified plasmid DNAs were sequenced using Big Dye Terminator (BDT ...
-
bioRxiv - Bioengineering 2021Quote: ... the Bxb1 or equivalent integrase/recombinase AttP sites and the cargo sequence were introduced into a minicircle parental plasmid with Gibson cloning using Hifi Assembly mix (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... we excised the tubulin gene from a pZJM.tubulin RNAi plasmid (a gift from James Morris, Clemson University) using XhoI (R0146S, New England Biolabs, MA) and HindIII (R3104S ...
-
bioRxiv - Neuroscience 2022Quote: ... starting from a pENTR3C-Raph1-WT plasmid and a pCAG-DEST-3xFLAG-2xStrep which was generated by HIFI assembly (NEB) using pCAG-EGFP (Addgene 89684) ...
-
bioRxiv - Developmental Biology 2022Quote: ... mutations of interest were introduced into the pMT-Ed::GFP::DlgPDZ3-SH3-HOOK-GUK plasmid (Garcia et al., 2014) using the NEBaseChanger site directed mutagenesis kit as directed by the manufacturer (NEB). To generate the cytosolic pMT-GFP: ...
-
bioRxiv - Genomics 2022Quote: ... The pooled oligos were next assembled into the NotI-HF-digested plasmid pSAC200 using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs) and transformed via electroporation into Endura Electrocompetent E ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We used 5 μL plasmid DNA as template in a 25 μL reaction volume with Q5 polymerase according to the manufacturer’s protocol (NEB # M0491L). Reaction was incubated in a thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were introduced into the phCMV-Spike plasmids using the mutagenic primers and the Q5 site directed mutagenesis kit (NEB). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... b1-8 leader-EGFP was switched to a b1-8 leader-SNAP-tag by amplifying the SNAP-tag sequence with GAGGTTAACGAATTCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAG GTGTCCACTCCATGGACAAAGACTGCGAAATGAAGCG and TCTGCTGGCGGCCGACCCAGCCCAGGCTT and cloning into the plasmid with the in-fusion enzyme using the EcoRI and NotI (NEB) restriction sites before and after the b1-8 leader-EGFP sequence.
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were linearised with NsiI located directly downstream of the (A)49 sequence and treated with Klenow fragment (NEB M0210S) to generate blunt-ends ...
-
bioRxiv - Biophysics 2022Quote: pG5E4-5S plasmid (5190 bp, a gift from the Williams lab at UNC-Chapel Hill) was linearized using NdeI restriction enzyme (NEB) and purified using the Qiagen PCR purification kit ...
-
bioRxiv - Microbiology 2019Quote: ... The empty vector pKH37 and the plasmids containing the desired ponA sequences were methylated with HaeIII methyltransferase (New England Biolabs), linearized with the restriction enzyme PciI (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Microbiology 2019Quote: ... The dephosphorylated/restriction enzyme modified plasmid and phosphorylated amplicons were mixed and the ligation reaction was carried out using T4 DNA ligase (NEB) as instructed on NEB’s website ...
-
bioRxiv - Biochemistry 2019Quote: ... were produced by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutations (Table S9) followed by DpnI (NEB) treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... to create overhanging sequences. The plasmid pIL-SV (AlKhatib, Lagedroste et al. 2014) was linearized by Phusion DNA polymerase (NEB) with the primer pair termpNZfor and pnisArev (Supplementary File 4) ...
-
bioRxiv - Genetics 2019Quote: ... The amplicons were gel-purified on a 4% agarose gel and assembled with the cut Lenti-gRNA-Puro plasmid described above using an NEBuilder HiFi DNA Assembly kit (NEB). After incubation at 50 °C for 1 h ...
-
bioRxiv - Physiology 2019Quote: ... The suicide delivery vector pEMG was isolated using the NEB Monarch Plasmid Miniprep Kit (New England Biolabs, Ipswich, MA, USA). The isolated plasmid was digested with restriction enzymes purchased from New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ng of the LMNB1 plasmid construct was subjected to a standard mutagenic PCR reaction with Q5 High Fidelity DNA polymerase (M0491, New England Biolabs) and 25 ng of specific primers ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.10-P plasmid was mutated by PCR using mutant primers and Q5 site-directed mutagenesis kit (New England Biolabs, E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Vent DNA Polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Vent DNA Polymerase (New England Biolabs (NEB)) ...