Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2232 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Cre-mediated removal of LoxP-flanked replication loci from pDN62x-series vectors was accomplished in vitro treating 250 ng plasmid with purified Cre recombinase enzyme (New England Biolabs) in 50 μL reaction per manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... We previously generated a human LRP5-V5 plasmid [32] and we used the Q5 site-directed mutagenesis kit (New England Biolabs) with forward primer (CTCAATGGCACATCCCGG ...
-
bioRxiv - Molecular Biology 2019Quote: ... Guide RNA sequence targeting human TLK1 exon 10 (TAACTGTTGTAAAGTGCCCG) were cloned into the plasmid pX330-CRISPR-Cas9-SV40prom-EGFP (Cong et al., 2013) after digestion with BbsI (NEB). Cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... The PCR product was used for a linear amplification reaction with plasmid pJV300 (pPL) using Phusion DNA polymerase (New England Biolabs), and the resulting product was digested with DpnI ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). pEMG plasmids were transformed into competent E ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plasmid harboring the trf1 disruption cassette with the HYGR marker (named pUTrf1-Hyg) was constructed through Gibson Assembly (NEB) of four overlapping PCR fragments ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The synthesized RBS-Bdh-FLAG insert was resuspended in water to a final concentration of 10 ng/µL and was assembled with linearized pBBR1-MCS2 plasmid using NEBuilder High Fidelity DNA assembly kit (New England Biolabs) using 50 ng of pBBR1-MCS2 and 100 ng of RBS-Bdh-FLAG insert ...
-
bioRxiv - Molecular Biology 2020Quote: Linear DNA templates for in vitro transcription were generated from pNB1u or pOO2-GW plasmid by PCR using Phusion High-Fidelity DNA Polymerase (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... targeting the C- or N-terminus of various genes were cloned into the p-HXGPRT-Cas9-GFP plasmid backbone using KLD reactions (New England Biolabs), as previously described (71) ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
Receptor-like role for PQLC2 amino acid transporter in the lysosomal sensing of cationic amino acidsbioRxiv - Cell Biology 2020Quote: ... These new plasmids were generated by Gibson Assembly or Q5 Site-Directed Mutagenesis according to manufacturer instructions (New England Biolabs). Primers for generating these mutants are listed in Table S1 ...
-
bioRxiv - Synthetic Biology 2021Quote: DNA encoding each trigger RNA used in experiments was either amplified from cloned plasmid or from genomic DNA of specified species of bacteria by PCR with Q5 DNA polymerase (New England Biolabs). Primers were designed to create linear DNA with a T7 promoter as well as additional protective sequences on the 5’ and 3’ ends of linear template ...
-
bioRxiv - Microbiology 2020Quote: ... The oligos were annealed and cloned into the PLJR962 plasmid using BsmBI restriction sites in an overnight ligation reaction with T4 DNA ligase (NEB). Following ligation ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product and the destination plasmid (pMMB67EH-Gen) were digested with the restriction enzyme EcoRI-HF and XbaI (New England Biolabs) and ligated with the T4 DNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... the destination plasmid and pJET-VP1881 were independently digested with the restriction enzymes SacI-HF and BamHI-HF (New England BioLabs). The digested fragments were purified using the DNA Clean & Concentrator-5 Kit and the Zymoclean Gel DNA Recovery Kit (Zymo Research ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’ overhangs of these primers were chosen to facilitate Gibson assembly of the four fragments into a single plasmid (NEBuilder HiFi DNA Assembly Master Mix; New England Biolabs). The resulting plasmid pRO405 was verified by restriction analysis and Sanger sequencing.
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Synthetic Biology 2019Quote: Plasmid cloning was performed using standard molecular biology techniques of PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... U.S.A.).These respectively were used to clone the genes into storage plasmids (level I) by Golden Gate assembly with BsmBI and T7 DNA ligase (M0318L, NEB) for subsequent assembly into expression cassette-bearing plasmids (level II ...
-
bioRxiv - Neuroscience 2020Quote: ... Intron-containing dCas9-VPR was constructed by the insertion of a gBlock containing the SV40 intron into the original dCas9-VPR plasmid via Gibson assembly (Gibson Assembly kit, New England BioLabs). The SVI-FLEX construct was built via Gibson assembly of the original dCas9-VPR backbone and two gBlocks encod-ing the SV40 intron sequence ...
-
bioRxiv - Developmental Biology 2020Quote: ... and placed under the control of the floor-plate specific 898bp Netrin1 enhancer (59) from a XhoI/NotI-digested pNetrin898:membCherry plasmid (Marie Breau, unpublished) by ligation with the T4 DNA ligase (NEB).
-
bioRxiv - Microbiology 2021Quote: ... was amplified by PCR using primers motAB-Fwd-KpnI and motAB-rev-SacI (Table S2) and ligated into plasmid pBBR1MCS-3 after restriction with enzymes SacI and KpnI (NEB). Ligation products were transformed into E ...
-
bioRxiv - Microbiology 2019Quote: ... meliloti 2011 strains containing the plasmid pRK-MS2-rnTrpL was performed using MS2-MBP fusion protein bound to amylose beads (New England Biolabs) as described by Smirnov et al ...
-
bioRxiv - Microbiology 2019Quote: ... The products of the HiFi reaction were transformed into either NEB-10beta (for chlamydial transformation plasmids) or DH5alpha (Iq) competent cells (NEB), plated on appropriate antibiotics ...
-
bioRxiv - Developmental Biology 2020Quote: ... was PCR amplified from cDNA to incorporate Nco1 and Kpn1 sites and ligated into the pETM-82 expression plasmid via Gibson assembly (NEB)32 ...
-
bioRxiv - Physiology 2019Quote: ... The human equivalent of the c655 mutation (G865V) was introduced into this plasmid using the Q5 Site-directed mutagenesis kit (New England Biolabs), with the following primer pair ...
-
bioRxiv - Cell Biology 2019Quote: ... The homology donor vectors were constructed by PCR amplifying the template plasmid pLJ851 using Q5 DNA polymerase (New England Biolabs) with 110-base oligonucleotides using a 80-base homology sequence to the N terminal region of the SENP6 gene ...
-
bioRxiv - Genomics 2021Quote: ... The FPR cassette comprising NatMX-mCherry-PPT1/SUT129 promoter-YFP was excised from the backbone using AscI restriction enzyme (1 U per µg plasmid, NEB). Fragment I was the bidirectional GCG1/SUT098 or ORC2/SUT014 promoter sequences amplified by Phusion U polymerase from BY4741 genomic DNA ...
-
bioRxiv - Genetics 2020Quote: The annealed sgRNA oligos were diluted 1:200 in water and ligated into the pX459 plasmid that has been linearized with restriction enzyme BbsI (New England Biolabs). The ligation mixture contained 2 ul of diluted sgRNA oligos ...
-
bioRxiv - Genetics 2020Quote: ... plasmid containing native 3’-UTRs were generated by excision of the 2xMyc-ADH1 3’-UTR from each RRP4/40-Myc LEU2 CEN6 plasmid by restriction digestion and cloning of the native RRP4 or RRP40 3’-UTR into each plasmid using NEBuilder HiFi Assembly (New England BioLabs).
-
bioRxiv - Genetics 2020Quote: ... and inserted into the pET28a plasmid between the EcoRI and XhoI restriction sites using 2X HiFi DNA Assembly Master Mix (New England Biolabs) to create pET28a-SaCas9-KKH ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB) creating pmpsB ...
-
bioRxiv - Genetics 2020Quote: ... containing the silent mutations to stem 2 of SARS and SARS-CoV2 (IDT) into the plasmid using T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... the SV40 promoter was removed from the luciferase-enhancer plasmids by restriction digestion with BglII and HindIII-HF (both NEB). The Fgf5 promoter region - encompassing the 300 bp region containing most of transcription initiation events in PRO-Cap-Seq data at the 5’ UTR of the gene plus 100 bp of flanking nucleotides on each side - was amplified by PCR and inserted in place of the SV40 promoter by Gibson Assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... tRNA containing plasmids were linearized using restriction digestion and tRNAs were in vitro transcribed overnight using the HiScribe T7 transcription kit (NEB) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... pAGB1139 was cut with BamHI and EcoRI so that each insert could be cloned into the plasmid via NEBuilder HiFi DNA assembly reaction (NEB). The primers AGO2350 and AGO2351 were used to amplify the following mNeonGreen-tagged ORFs for assembly into pAGB1139 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting product was cloned into pAGB879 cut with BglII and SacI (to remove Fxr1-turboGFP from the plasmid) using the NEBuilder HiFi DNA assembly reaction (NEB). To make pAGB1111 ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5-eRF3a-F76a was removed from pCI-MS2V5-eRF3a F76a plasmid (a gift from Niels Gebring) by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). To generate pCI-FLAG-GSPT1 ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5 was removed from pCI-MS2V5-eRF3a F76a plasmid and an N-terminal FLAG tag was inserted to the same plasmid by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). The F76a mutation was mutated back to wildtype using In-fusion cloning (Clontech).
-
bioRxiv - Microbiology 2021Quote: The DNA template for T7 transcription was prepared by linearizing the T7 replicon plasmid (#453, Supplemental Table I) with the restriction enzyme SacII (NEB), followed by protease K treatment ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were cloned into the plasmid backbones using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.
-
bioRxiv - Bioengineering 2021Quote: ... The tagRFP-psd construct was cloned into the pRS316 plasmid (Huang and Shusta 2005) (a gift from Dr. Eric Shusta) using restriction enzymes NotI and BsrGI (New England Biolabs) under the galactose inducible GAL1-10 promoter ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... V796A mutations were inserted into the GFP-α-catenin plasmid using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Neuroscience 2021Quote: ... These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs, USA) or in-Fusion HD cloning kit (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Genetics 2021Quote: ... containing 200 ng of digested plasmid and 37.7 ng of library was performed followed by cleanup and electroporation into DH5α electrocompetent cells (NEB, C2989K). Transformed bacteria were pooled ...
-
bioRxiv - Biophysics 2021Quote: ... To do so the SH3 domain was amplified by PCR reaction using primer pair oGJJ012-13 to introduce the flanking HindIII and NheI restriction sites and then cloned into the digested pGJJ045 plasmid using T4 Ligase (NEB).
-
bioRxiv - Microbiology 2021Quote: Produce the full-length DWV-GFP in vitro RNA transcript from linearized plasmid DNA template by HiScribe T7 RNA polymerase (New England Biolabs) according to manufacturer’s guidance ...