Labshake search
Citations for New England Biolabs :
1851 - 1900 of 2232 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... and assembled between the FRT sites of plasmid pKD4 by gibson assembly using NEBuilder HiFi DNA Assembly master mix (NEB). 2x tRNA cassettes integration plasmids were constructed from a 2x-tRNA construct under the control of a proK tRNA promoter and terminator and separated by a valU tRNA linker that was ordered as a DNA fragment from Genewiz ...
-
bioRxiv - Molecular Biology 2022Quote: ... and subsequently cloned via Gibson Assembly in the pRRL-EF1a-XhoI-IRES-BlastR plasmid (gift from G. Superti-Furga) using the NEBuilder HiFi DNA Assembly Mix (New England Biolabs). The CRBN/VHL WT and point mutant plasmids were used for lentivirus production and subsequent transduction in RKO CRBN-/- and VHL-/- clones respectively.
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Molecular Biology 2022Quote: ... were generated by deletion of the unwanted DNA from the parental plasmid using the Q5 Site-Directed Mutagenesis Kit (NEB BioLabs). The R763G point mutation was introduced into D1-A1 by PCR mutagenesis ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA fragments into plasmid pODC53 (Caspari, 2020) upstream of Venus using Gibson assembly (NEBuilder HiFi DNA assembly, #E5520S, New England Biolabs). Chlamydomonas TP sequences were amplified from genomic DNA extracted from strain T222+ (CC-5101) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A donor DNA containing two homology arms flanking the DsRed sequence for homology repair were cloned into the pHD-ScarlessDsRed plasmid (https://flycrispr.org/scarless-gene-editing/) using the Q5® High-Fidelity DNA Polymerase kit (New England Biolabs). Left homology arm contained the sequence in 2R:9870299-9871095 (FlyBase Release 6 ...
-
bioRxiv - Plant Biology 2022Quote: ... gRNA modules were combined with pGG-C-linker-G plasmid and cloned into pEN-R2-A-G-L3 by restriction-ligation using BsaI enzyme (New England Biolabs) to obtain pEN-R2-gRNA_BRI1-3-gRNA_BRI1-2-L3 ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Molecular Biology 2023Quote: ... these antibiotic resistant cassettes were excised by transforming the strains with a plasmid expressing the Cre recombinase (pDR244, BGSCID: ECE274) purified from RecA+ Escherichia coli (NEB) cells with the GeneJET Plasmid Miniprep Kit (Thermo) ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Biophysics 2022Quote: ... The PCR product was digested by HindIII and NheI then was cloned into the digested pGJJ162 plasmid using T4 Ligase (NEB). To construct 6 KRAS BindingPCA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNAs for each of the 4 constructs were sequentially digested with SacI and BamHI (New England Biolabs, Ipswich, MA), purified by gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR product was integrated in the pMV261 (81) plasmid digested with AatII and EcoRI using the Gibson Assembly strategy according to the manufacturer protocol (NEB).
-
bioRxiv - Microbiology 2023Quote: ... PYD and HD mutants were generated from full length IFI207-HA plasmids and the R1-PYD mutant from R1-IFI207 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). IFI207-HIN plasmids were generated by PCR amplification of the HIN domain from full length IFI207-V5 expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product and pLV IRES-Hygro plasmid backbone were assembled using HiFi DNA Assembly Master Mix (NEB Cat#: M5520AA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the C-terminus of the Apoptin encoding plasmid was removed and replaced with the Mxe-GyraseA Intein using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). Sanger sequencing of resulting plasmids was carried out by GENEWIZ.
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were constructed using scarless assembly reactions to insert oligos into plasmid backbones (BbsI-HF-v2, 1X T4 DNA ligase buffer, T4 DNA ligase; NEB). For amino acids with six synonymous codons (leucine ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The supernatant was removed and treated with DpnI to degrade template plasmid DNA (Catalog No. R0176S, New England BioLabs Inc.). The mixture was incubated at 37°C for 15 minutes (T100 Thermal Cycler ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were combined into a transcription unit plasmid in a Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs). The destination vector (p15A origin of replication ...
-
bioRxiv - Cell Biology 2023Quote: ... the SNAP-tagged fragment was assembled into a ApaI digested MBO2-HA plasmid using NEBuilder (New England Biolabs, Ipswich, MA). The final N-SNAP-MBO2-HA construct encodes an MBO2 polypeptide with a SNAP tag at its N-terminus and a 2-HA tag located between amino acids 885 and 886 of the original MBO2 sequence (Supplemental Figure S1).
-
bioRxiv - Neuroscience 2023Quote: ... the CMV PSAM4 GlyR WPRE BGH pA plasmid was subjected to an overnight restriction digestion reaction using BsaI-HF v2 (NEB). The restriction reaction products were run on a gel ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid pJH114 was used to create the plasmid pJH114-ΔB encoding BamACDE by deleting the bamB gene using the Q5 Site-directed mutagenesis kit (New England Biolabs). The bamA gene ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 μg of pSCW01 plasmid was treated with 1.5 units/μg of site specific endonuclease Nt.BstNBI (New England Biolabs, Ipswitch, MA) and 100X molar excess of displacer oligonucleotides (DNA197-199 ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Bioengineering 2023Quote: Double-stranded linear DNA template for HDR and electroporation was amplified from plasmid DNA by PCR using Q5 High-Fidelity Master Mix (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: Purified PCR products and enzyme digested plasmid were then ligated together in a gibson reaction using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s protocol resulting in pUC19-3xP3-DsRed-attB-Gypsy-MCS-no-BbsI ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Microbiology 2023Quote: ... or BamHI/SalI for pDL277 and the genes of interest were ligated into the respective plasmids with T4 DNA ligase (NEB). Additionally ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified target genes and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and HinDIII (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The origin of replication and antibiotic resistance gene fragments were obtained from source plasmids by PCR amplification with Q5 HiFi DNA polymerase (NEB). The multiple cloning site ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was then done with the homologies to construct the initial green fluorescent protein (GFP) plasmid and then transformed into competent E.coli (NEB#C2984H) and subsequently sequenced (Plasmidsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... cells by introducing either a truncation or a substitution into the parental pFE127 plasmid via site-directed PCR-based mutagenesis (KLD enzyme mix, New England Biolabs). Protein expression was induced for 4 h at 37°C by adding 1 mM IPTG when cell cultures reached OD600 nm ∼0.5 in LB with ampicillin ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Bioengineering 2023Quote: ... Ligation of the gRNA expression cassette sequence into the pCas9-amdSYM plasmid was made using a T4 DNA ligase (NEB). Yeast cells were transformed using the yeast transformation procedure described in [14] and selected on YNB Acetamide plates (1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Sequence-verified sub-part plasmids are then used as inputs for assembly into carbenicillin-resistant entry vectors using BsaI-v2 HF (NEB) to yield genetic part plasmids (i.e. ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA fusion targets were transcribed from plasmids using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA), isolated using the Monarch Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
bioRxiv - Molecular Biology 2023Quote: IS element excision from the plasmid backbone was detected by PCR using OneTaq 2X Master Mix with Standard Buffer (NEB) and 0.2 uM primers ...
-
bioRxiv - Microbiology 2023Quote: ... were amplified using primers 1632/1633 and 1634/1324 and sequentially cloned and inserted into the PbC-3XHA-mCherry hDHFR plasmid at XhoI/BglII and NotI/AscI (NEB), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... with 25–30-bp overlap and used to generate plasmids via the Gibson assembly method65 using T5 exonuclease (New England Biolabs), Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Microbiology 2023Quote: ... and AcrIIA4 protein purification were generated by amplifying the backbone from the AcrVA1 plasmid and cloning in other open reading frames using HiFi assembly (NEB). E ...
-
bioRxiv - Biochemistry 2022Quote: ... Inserts were then digested according to manufacturer’s protocol with Nsi-I HF and Hind-III HF and ligated into a calf-intestinal phosphatase treated plasmid using T4 DNA ligase (New England Biolabs). The resulting recombinant plasmid contained an ampicillin resistance cassette and the riboswitch insert located upstream of the fluorescent reporter protein mNeonGreen.79 The plasmid’s transcription is controlled by the moderately strong synthetic promotor ‘proD’80 which has previously been used to study the env8 class-II Cbl riboswitch.59 ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA of NmeCas9 was synthesized by in vitro transcription with T7 RNA polymerase and plasmid DNA templates linearized by HindIII-HF (New England Biolabs). The sgRNA sequence was listed in Supplementary Table S1 ...