Labshake search
Citations for New England Biolabs :
1901 - 1950 of 2065 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM MgCl2, 1% CHAPS,2.5 mM DTT, 50 µg/mL cycloheximide, 20 U RNase inhibitor murine, New England BioLabs, EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Genetics 2023Quote: ... The remaining beads were incubated with 1 ul RNasin (Fisher) and 0.5 µl of 20 mg/ml Proteinase K (NEB) at 42°C and 1200 rpm for 15 minutes in a thermomixer ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 μl of 0.1∼1 μg genomic DNA was mixed with 10 μl of 2X C-circle master mix [0.2 mg/ml BSA (NEB), 0.2% Tween-20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.0-3.0 μg of DNA was used for a ligation reaction in a volume of 1 mL using 1.0 μL of 2000 U/μL T4 DNA Ligase (NEB) for 3C experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified supernatant was then batch-bound for 3 hours on to 20 mL chitin resin (New England Biolabs) equilibrated with 200 mL of cell lysis buffer ...
-
bioRxiv - Biophysics 2023Quote: A 2070-bp DNA handle was amplified by PCR from λ DNA template (final 2.5 µg/ml; NEB, N3011S) using a forward primer (TAAGGATGAACAGTTCTGGC ...
-
bioRxiv - Microbiology 2023Quote: ... Glycans were removed by incubating the immunoadhesins ON at room temperature (RT) with endoglycosidase H (endo-H, 0.8 U/mL, #P0702L, New England Biolabs) in 50 mM Na acetate-50 mM NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Systems Biology 2024Quote: ... the cDNA was diluted to 0.05 µg/ml and PCR-amplified using Phusion DNA polymerase (New England Biolabs M0530) with 0.5 mM dNTPs ...
-
bioRxiv - Biophysics 2023Quote: ... single-molecule fluorescence transients were recorded on a wide-field microscope after the addition of 0.5 µL of XhoI (20.000 units/mL, New England BioLabs, USA).
-
bioRxiv - Microbiology 2023Quote: ... Enzymes BsaI-HF®v2 (#R3733S) and BsmBI-v2 (#R0739S) (10.000 U/mL) and T7 ligase (#M0318S) were obtained from New England Biolabs (NEB). PCR amplicons were first cloned into the pYTK001 entry vector before assembly into a composite construct using preassembled vector backbones with GFP dropouts ...
-
bioRxiv - Biochemistry 2023Quote: ... Snap-cooled RNAs were diluted to 8 nM in 2x RNA master mix (0.2 mg/mL bovine serum albumin (molecular biology grade, NEB), 0.2 mg/mL yeast tRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligation reactions were quenched by addition of EDTA to 25 mM and proteins were digested by incubation at 37°C for 20 min with 0.1% SDS and 20 units/ml proteinase K (NEB). Unligated oligonucleotides were removed by gel filtration through a 50 cm x 0.7 cm Sepharose 4B column (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) or GST-fusion proteins for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated at 37°C for 12 minutes and then washed with 0.1 3 SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L). RNA released from the permeabilized tissue and captured by the DNB was reverse transcribed overnight at 42C using SuperScript II (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Biochemistry 2024Quote: ... then diluted to 8 nM concentration in 2x RNA master mix (0.2 mg/mL bovine serum albumin (molecular biology grade, NEB), 0.2 mg/mL yeast tRNA ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... treated or not for one hour at 56°C with 0.4 mg/mL proteinase K (P8107S, New England Biolabs) and then heated or not for one hour at 85°C.
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μg/ml phenylmethylsulfonyl fluoride and protease inhibitor) and resuspended again in 1 ml MNase digestion buffer with 1,250 Units MNase (NEB Biolabs). Chromatin-MNase mix was incubated at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were then incubated overnight at 37 °C in Hybridization Buffer (10% Formamide, 10% 20x SSC, 400 µg/ml E. coli tRNA (New England Biolabs), 5% dextran sulfate ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA oligonucleotides were diluted (and mixed) to the desired concentration in buffer solution with 2 mg/mL BSA (Molecular Biology Grade, New England Biolabs) to minimize DNA adsorption to tubing and pipette tips and loaded to inlet port 3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... for the presence of all core TFIIH subunits and appropriate fractions were pulled and mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in washing buffer (400 mM KCl ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... samples were incubated for 1 h at 37°C in the presence or absence (mock) of 0.5 μl of Endo Hf enzyme (106 U/ml; NEB, USA).
-
bioRxiv - Microbiology 2021Quote: ... 15 μL of PCR product were mixed with 5 μL of a 5X Exo-SAP solution (15% Shrimp Alkaline Phosphatase – 1000U/ ml – NEB, 10% Exonuclease I – 20000 U/ ml – NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was ligated by incubation at 16°C for 5h in 4 ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... at 98,000 × g at 4 °C for 45 min and the supernatant loaded onto a self-packed column with ∼10 ml of amylose resin (NEB) pre-equilibrated in 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Systems Biology 2022Quote: ... 10 μl of eluted DNA were mixed with 40 μl of A-tailing mix (0.25 mM dATP, 125 U/ml Klenow fragment (cat. # NEB M02105S), and Klenow buffer 1.25 X ...
-
bioRxiv - Physiology 2022Quote: ... 1 L of diluted extracts were incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue-gel samples were then transferred into a 2 ml Eppendorf tube and digested overnight (37 ℃) in Proteinase K buffer (750 µl) with 7.5 µl of 800U/ml Proteinase K (NEB, P8107S). After digestion samples were trimmed again and washed in PBS (4 × 15 min).
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 15 μl of 10 mg/ml BSA and 10 μl of 400 U/μl of T4 DNA ligase (NEB, M0202)) and incubated 4h at 16ºC with mixing (800 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cross-linking was reversed overnight by treating samples with 200 mM NaCl and 250 μg/mL Proteinase K (New England Biolabs) and incubating overnight at 65°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribosome concentrations were calculated with a NanoDrop spectrophotometer assuming 1A260 = 60 μg ribosome mL−1 (conversion factor provided by New England Biolabs). This conversion factor was used to estimate the molecular mass of bacterial ribosomes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotin removal from unligated fragments was performed by incubating DNA samples for 4h at 20C in a mix of 5 mL of 10X NEB2 buffer (New England Biolabs), 5 mL of a 1mM dNTPs mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were pooled and treated for 1 hour at 37°C with 250 u /ml of Exonuclease I (NEB). Libraries were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) ...
-
bioRxiv - Genomics 2021Quote: ... 10% Dextran sulfate Sigma D8906; 0.02% BSA Ambion AM2616; 1 mg/ml E.coli tRNA Sigma R1753; 2 mM Vanadyl-ribonucleoside complex NEB S1402S; 2XSSC) containing diluted probes and incubated over night at 30°C ...
-
bioRxiv - Genomics 2021Quote: ... and the cells was washed once with wash buffer (PBS with 1% BSA and 40 units/ml of RNase inhibitor, murine (NEB)) ...