Labshake search
Citations for New England Biolabs :
1651 - 1700 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... PCR product was ligated using T4 ligase (NEB) and amplified using outer primers to produce the fusion gene S1R-APEX2 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR master mixes (NEBNext High fidelity, M0541S, NEB) containing unique barcoding primers per well were dispensed on top of the reverse crosslinking buffer and DNA was amplified with the following cycling conditions ...
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR using Phusion Polymerase (NEB). The amplicons and the linearized plasmid were assembled using an NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR products were ligated with T4 ligase (NEB). The resulting plasmid (pRG85_CM ...
-
bioRxiv - Biophysics 2020Quote: ... we PCR amplified a Lambda DNA fragment (NEB) of ~50% GC-content with the oligonucleotides 114.F RNA control 612 and 113.R RNA control 1316 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subsequently digested with Dpnl (NEB) to eliminate residual plasmid sequence and purified with QIAquick PCR Purification columns (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR with Phusion High Fidelity DNA Polymerase (NEB) or iProof DNA Polymerase (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out using Q5 polymerase (NEB) with genomic DNA as template from their respective mutant in MKP103 background [91] and primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was ligated into NruI (NEB) digested pEAQ-HT Nicotiana benthamiana overexpression vector (Sainsbury et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... PCR reaction and a KLD enzyme mix (NEB). The resulting plasmids were transformed into chemically competent DH5α cells and sequences were confirmed by Sanger double stranded DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Standard PCRs were run using Taq Polymerase (NEB) using primers provided in Supplemental Table 3 ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry was PCR amplified with Q5 polymerase (NEB) using primers JM403 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAATGAAAGCCTTCACACTCGCTCTC TTCTTAGCTCTTTCCCTCTATCTCCTGCCCAATCCAGCCATGGTGAGCAAGGGCGA GGAGG-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... barcode PCR amplification using Q5 DNA polymerase (NEB) and Illumina adaptor-encoded primers that include unique 6-bp TruSeq indexes in the forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified (Phusion DNA polymerase; New England Biolabs) and cloned into the NheI and NcoI restriction site of the AAV-EF1a-DIO-EYFP vector ...
-
bioRxiv - Microbiology 2020Quote: ... and then PCR amplified for 20 cycles (NEB Phusion Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... all PCR reactions were performed using Phusion (NEB) with primers to add a 5’ Eco52I restriction site and a 3’ KpnI restriction site (see Supp Table 3 for oligos) ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR products were digested using DpnI (NEB) at 37°C for 90 minutes and then transformed into DH5α chemically competent cells ...
-
bioRxiv - Microbiology 2019Quote: ... PCRs used the high-fidelity Q5 polymerase (NEB) per suggested protocols ...
-
bioRxiv - Genomics 2020Quote: ... PCR fragments were treated with Nb.BbvCI nickase (NEB) before purification and ligating the Y-shape with the correct overhang ...
-
bioRxiv - Microbiology 2019Quote: ... PCR fragments were blunted using Klenow fragment (NEB) and cloned into pUC57 and sequenced.
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR-amplified using the Phusion polymerase (NEB) and specifics primers flanking exon 6 of the STAU1 gene (sense ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was done with Q5 polymerase (NEB) performed on a LightCycler 96 System (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... We used the Phusion PCR polymerase mix (NEB) containing 25 pmol each of the following two oligo sequences ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR fragments were amplified using Q5 polymerase (NEB), and vectors were double-digested with NEB restriction enzymes and ligated to gel-purified PCR products using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2019Quote: Colony PCRs were run using Taq polymerase (NEB) with Thermopol buffer ...
-
bioRxiv - Genomics 2020Quote: ... PCR was performed with Phusion DNA polymerase (NEB) and we used a slow ramp for the elongation step from 72°C to 98°C to allow the synthesis of the loop on the reverse primer ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed with Q5 (New England Biolabs) and KOD (Novagen ...
-
bioRxiv - Microbiology 2020Quote: All PCR was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Dataset 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR product was digested with DnpI (Biolabs) for 5hr and transfected into E ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR products were then phosphorylated (NEB M0201S) and ligated (NEB M0202S ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplification was performed with LongAmp Polymerase (NEB) or PrimerStar GXL (Takara) ...
-
bioRxiv - Biophysics 2021Quote: ... amplified by PCR (Q5-Hot Start Polymerase, NEB) using oligos oGJJ078-79 to add a HindIII and NheI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using Q5 polymerase (NEB) with AZ101 genomic DNA as template ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed using Phusion DNA polymerase (NEB) and corresponding primers (Table I) ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using Q5 DNA polymerase (NEB). A 227 bp fragment of the mitochondrial ATPase subunit-1 gene was amplified from the bisulfite converted and non-converted DNA samples using the degenerate ATP1.1-F and ATP1.1-R primer pair described previously36 ...
-
bioRxiv - Cancer Biology 2022Quote: ... using PCR (Q5 High-Fidelity DNA Polymerase, NEB) and Gibson Assembly (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was carried out using Q5 polymerase (NEB) according to manufacturer’s recommendations with 500 nM of the following primers (lower case indicating nucleotides added for cloning purposes ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR product was digested with DpnI (NEB) for 2 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... or PHUsion polymerase for PCR products >2,000bp (NEB) with respective primers as provided in Supplemental Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Luna One-Step qRT-PCR (New England Biolabs) using the primers for each specific gene of interest (Table 2) ...
-
bioRxiv - Physiology 2023Quote: ... Both PCR products were digested with PstI (NEB) and ligated using a T4 DNA ligase ...
-
bioRxiv - Neuroscience 2022Quote: ... Mrj was PCR amplified using Q5 polymerase (NEB) using TopoD-Entr-Mrj clone as a template ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were subsequently digested by DpnI (NEB) and transformed into DH5α E ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB). Heterozygous enhancer deletions were generated to facilitate allele-specific SOX9 gene expression analysis.
-
bioRxiv - Genetics 2023Quote: PCR was performed using OneTaq polymerase (NEB #M0480). Reactions consisted of 1X OneTaq Standard Reaction Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed with Q5 polymerase (NEB) unless specified otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments were PCR amplified using Q5 polymerase (NEB) and vectors were digested using restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were obtained using Q5 Polymerase (NEB) or Expand Long Template PCR system (Roche/Sigma ...