Labshake search
Citations for New England Biolabs :
1801 - 1850 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... PCR was performed using LongAmp Taq Master Mix (NEB) under the following conditions ...
-
bioRxiv - Microbiology 2019Quote: ... DNA polymerases in PCR were Phusion (New England Biolabs) for synthesis of DNA used in constructions and DreamTaq (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or amplified by PCR (Q5 Polymerase; New England Biolabs) to swap the restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: qRT-PCRs were performed using Luna OneStep reagent (NEB) on biological triplicates ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... A 50 μl PCR using Q5 polymerase (NEB M0491S) according to the manufacturers instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The two PCR products were treated with DpnI (NEB) for 30 min at 37 “C ...
-
bioRxiv - Genomics 2019Quote: ... a PCR was performed using Taq polymerase (NEB, USA) with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich ...
-
CRISPR-Cas12a/Cpf1-assisted precise, efficient and multiplexed genome-editing in Yarrowia lipolyticabioRxiv - Synthetic Biology 2019Quote: ... Primers and Q5 PCR mix (New England Biolabs, USA) were added to perform colony PCR ...
-
bioRxiv - Genomics 2020Quote: ... The PCR products were digested by T7E1 enzyme (NEB), resolved on 2% agarose gel and then analyzed by densitometry measurements as described [63] ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) was dispensed twice using the ICELL8 MSND Single Cell / TCR program for the filtered dispense tool at 50 nanoliter per well ...
-
bioRxiv - Genomics 2020Quote: ... the NEBNext High-Fidelity 2× PCR Master Mix (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed using Taq Polymerase (New England Biolabs), and Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were cut using EcoRI and HindIII (NEB). End-labelling was done using γ32-ATP and T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Completed PCR reactions were treated with exonuclease I (NEB) according to the manufacturer’s protocol and then purified with the QIAquick PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3xFLAG was amplified by PCR with Q5 polymerase (NEB) from our construct using primers 3xFLAG_F and 3xFLAG_R and cloned into petSUMO_NSP1_WT vector using Gibson Assembly® Master Mix (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... with four inserts using Q5 polymerase PCR products (NEB): pCS2+ backbone ...
-
bioRxiv - Genetics 2019Quote: ... and NEBNext High-Fidelity 2X PCR Master Mix (NEB) which resulted in dual barcoded amplicons with illumina adapters ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext HiFi 2× PCR Master mix (NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We used high-fidelity PCR (Phusion, New England Biolabs) to amplify 150bp containing the mutagenized region ...
-
bioRxiv - Microbiology 2020Quote: ... Pooled colony PCRs were performed using Q5 polymerase (NEB), annealing at 65 °C and with a 50 second extension time.
-
bioRxiv - Bioengineering 2021Quote: ... A fresh 50 μL PCR reaction with Q5 (NEB) for 16 cycles annealing at 67 °C was mixed with 1 μL of ExoI (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... Inserts were assembled by PCR with Q5 polymerase (NEB), gel purified (Epoch Life Science) ...
-
bioRxiv - Microbiology 2020Quote: ORF20 or ORF20-RHIMmut were PCR amplified (Phusion, NEB), a V5 tag incorporated and inserted into the pCDH-EF1 vector ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified PCR product was digested by SacI (NEB) and Hind? (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR reactions were performed using Q5 DNA polymerase (NEB) and Expand High Fidelity PCR System (Roche Life Science ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reaction contained 1x Q5 Reaction Buffer (NEB), a detergent-free buffer containing 2.0 mM Mg++ at final 1x concentration ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using Q5 polymerase (New England Biolabs) according to manufacture instructions ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF05 and EF06 primers ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF07 and EF08 primers ...
-
bioRxiv - Microbiology 2020Quote: ... Synthesized DNA was amplified by PCR (NEB Q5 polymerase) and cloned into pDONR/Zeo (Thermo ...
-
bioRxiv - Plant Biology 2020Quote: PCR amplification with PHUSION High-Fidelity Polymerase (NEB, M0535S) or Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR was performed using Phusion polymerase (New England Biolabs) using a 90 second elongation for 35 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplification was performed by PCR using Q5 polymerase (NEB) for 26-28 cycles using primers carrying dual indexes as previously described15 ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions were done using Q5 polymerase (NEB). Primers used and knockouts constructed are described in Supplementary Tables 9 and 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 25 µl NEBNext HiFi 2x PCR Master mix (NEB) was added to each ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the Taq DNA Polymerase (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB, R0176) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant PCR products were introduced into NheI (NEB) linearized ToxoXpress vector (pTXP ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified PCR product was digested by BamHI (NEB) and NotI (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and plasmid was PCR-linearized by Q5 polymerase (NEB) using primers (IDT ...
-
bioRxiv - Microbiology 2020Quote: PCR reactions were carried out using Phusion polymerase (NEB) according to the manufacturer’s recommendations with the following primers ...
-
bioRxiv - Genomics 2021Quote: ... PCR was done with the Phusion DNA polymerase (NEB), using the following program ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were digested with DpnI (New England BioLabs) overnight at 37°C and purified using Qiagen PCR Purification kit ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 were constructed by PCR (Phusion polymerase, NEB) using a full-length version of the constructs ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR was performed using Phusion high-fidelity polymerase (NEB) to add a T7 promoter sequence with custom primers (forward ...
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were purified using Thermolable Exonuclease I (NEB), diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB; M0491L) with primers that had 500 bp homology to both KPPR1S and MKP103 on either end of the transposon cassette ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Enzymes for PCR and cloning were purchased from NEB. Plasmids were cloned into either Top10 E ...