Labshake search
Citations for New England Biolabs :
1601 - 1650 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 200-275 base pair region containing the relevant sgRNA target sequence was PCR-amplified from genomic DNA using the NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs) in a 25 µL PCR reaction volume (primer sequences appear below) ...
-
bioRxiv - Genomics 2022Quote: ... Transposed DNA fragments were amplified for 13 cycles in the presence of Custom Nextera PCR primers (Buenrostro et al., 2013) using the NEBNext High-Fidelity 2x PCR Master Mix (Cat. #M0541, New England Biolabs). Libraries were purified using the High Pure PCR Production Purification Kit (11732676001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by a single-cycle of PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) (98°C for 10 sec pre-denaturation followed by 98°C for 5 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina multiplex and bar code primers were added by PCR (1 µL of MMEJ product and 200 nM primers in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with 98°C ...
-
bioRxiv - Genetics 2022Quote: ... DNA of Del1 and Del2 from Family 1 were used to amplify different haplotypic fragments with long-range PCR or TD-PCR (Table S17) adding restriction enzymes (MluI and KpnI, NEB) on the 3’ of primers ...
-
bioRxiv - Genetics 2022Quote: ... The two PCR fragments were PCR-stitched with primers B1012 and B1366 and inserted by NEBuilder HiFi DNA Assembly (New England Biolabs) into MluI of pBN523 ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The two flanking regions of the chosen genomic exchange region were amplified and joined with PCR fragment carrying antibiotic resistance cassette by overlapping PCR using Q5 polymerase (New England BioLabs). Next ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 uL of 2xphusion PCR mastermix (Phusion High-Fidelity PCR Master Mix with HF Buffer – 100 rxns, NEB, cat #M0531S), 0.625uL of 100uM F primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ligated dsDNA products were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) with 200 nM of Illumina multiplex and index barcode primers (98°C for 10 sec pre-denaturation followed by 15 cycles of 98°C for 5 sec ...
-
bioRxiv - Genomics 2023Quote: ... 10µL of transposed DNA was amplified in a 50µL PCR reaction using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541S) for 5 cycles after a 5 min elongation step ...
-
bioRxiv - Developmental Biology 2023Quote: Five PCR reactions of 50 μl PCR mixture were made and amplified using Q5 High-Fidelity DNA polymerase (M0491; NEB). Next ...
-
bioRxiv - Genetics 2023Quote: ... 50 µl PCR reactions were performed for each timepoint using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with 20 to 50ng of template isolated plasmid DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... from which a 500 bp dsDNA containing the λC31 attB at its center was generated by PCR using Phusion High Fidelity PCR Master Mix from NEB. After heat denaturation ...
-
bioRxiv - Biochemistry 2022Quote: ... or mutants W79F and I176F were obtained by the overhang PCR or by the megaprimer PCR method respectively using Q5 (NEB) polymerase ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA cassette was PCR amplified from genomic DNA using Phusion High-Fidelity PCR Master Mix (New England Biolabs, M0531S). The amplified products were pooled and amplified again via PCR using primers harboring Illumina TruSeq adapters with i5 and i7 barcodes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and sgRNA cassettes were amplified using 22 cycles of PCR using NEBNext Ultra II Q5 PCR MasterMix (New England Biolabs). Sequencing was performed on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The flanking sequence of rs2248374 was amplified by PCR (Forward primer: AGGGAAAGAGAAGAATTGGA; Reverse primer: TCTCTTTCCTGTAGTGATTC) and PCR products incubated with the TaqI-v2 (R0149S, New England Biolabs) restriction enzyme (15 min at 65 °C) ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... eluted in 20 µl of water and PCR amplified using 25Lμl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541LL), 2.5Lμl of each i5 and i7 Illumina index adapter (IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... Vector and insert fragments were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF buffer from New England Biolabs (NEB). The fragments were analyzed by agarose gel electrophoresis and template DNA was digested using DpnI ...
-
bioRxiv - Bioengineering 2023Quote: ... genomic loci were amplified in a first PCR reaction (PCR-1) reaction from approximately 100 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers listed in Sup ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs) and the following primers:
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 µg of purified DNA (PCR product after 2nd round PCR after selections) was incubated with PstI-HF (New England Biolabs) at 37 °C for 1 h ...
-
bioRxiv - Synthetic Biology 2024Quote: Desired sequences were amplified using two subsequent PCR reactions using the Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB). All extension steps were carried out in a 15s timeframe and the first PCR round consisted of 10 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were immediately purified using a Qiagen minElute column and subjected to PCR amplification with NEBNext High-Fidelity 2X PCR Master Mix (NEB). Optimal PCR cycles were determined via qPCR to avoid over-amplification ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Biophysics 2019Quote: ... The PCR products were digested by DpnI (NEB) overnight at 37 °C and purified by a PCR purification kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Universal PCR primers and Index (X) Primer (NEB). PCR products were then purified (AMPure XP system ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: All PCR was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cut by BfaI (R0568S, NEB) in case of LRP5 KO and Hpy188III (R0622S ...
-
bioRxiv - Genetics 2021Quote: ... PCR was done using Q5 polymerase (M0492S, NEB). Primers used to detect the presence of amx cDNA were 5’-TCCCCGCTCTATCTGACCAA-3’ and 5’- GCTCTGTTGCCACATTTCCG-3’ ...
-
bioRxiv - Genetics 2020Quote: ... a large scale Phusion PCR (NEB, Ipswich, USA) was performed using a forward (5’-GAATTGTCTCGTTCGCAAATAC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplifications were performed with Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... six parallel PCR reactions (Q5 DNA polymerase, NEB) were set up with 30 µl of sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR using Q5 DNA polymerase (New England Biolabs) instead of KAPA HiFi ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR products were subsequently digested with AarI (NEB), and ligated to barcodes consisting of phosphorylated ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 1x PCR Master Mix (NEB, Cat#M0544). The samples were thermocycled at 72°C for 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The Phusion Polymerase PCR protocol (New England Biolabs) was followed for preparing 50μl reactions ...
-
bioRxiv - Microbiology 2019Quote: ... inverse PCR was performed using Q5 polymerase (NEB) and primers 847 and 1025 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Colony PCRs were performed with Taq polymerase (NEB). PCR products and digested plasmids were purified with the Monarch PCR & DNA Cleanup Kit (NEB) ...