Labshake search
Citations for New England Biolabs :
1551 - 1600 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: Hybridization with the reverse transcription primers was performed by adding 1 uL of SR RT Primer (NEB E7333A) to the above reaction and incubating at 75 C for 5 minutes ...
-
bioRxiv - Biophysics 2020Quote: Each reverse transcription (RT) reaction was performed using 50 ng total RNA in 1 mM dNTPs (NEB N0447S), 10% DMSO (Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Genomics 2019Quote: ... The cell lysate was centrifuged for 5min at 2,000g at RT and suspended in 500μl of 1X Restriction buffer 2 (NEB). This step was repeated thrice ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Cancer Biology 2019Quote: ... ligation was carried out at RT for 2h using 2000 U of T4 DNA ligase (New England Biolabs). DH5α cells (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR analysis was performed using New England Biotech LUNA SYBR Green qPCR reagents (New England Biolabs, U.K.). Glyceraldehyde phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription was carried out with 1.5 mM (high concentration) or 0.1 mM (limiting concentration) dNTP mix and 2.5 U AMV-RT (NEB, M0277S) and 1 hour incubation at 42°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ligation, samples were washed in CutSmart buffer, preincubated (5 min, RT) in 1x T4 ligase buffer (NEB), and incubated (18 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pif expression was assessed with the Luna® Universal Two-Step RT-qPCR Master Mix (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized via reverse transcription from ~500 ng of RNA using LunaScript RT Supermix (New England Biolabs). Transcripts of interest were subsequently quantified using Luna qPCR master mix (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Biophysics 2022Quote: To each time point sample add 0.5 μL of Proteinase K (NEB #P8107S) and incubate for 30 min @ 37 °C to digest all the proteins.
-
bioRxiv - Genetics 2023Quote: ... Mitotic duration was determined as the time (min) from nuclear envelop breakdown (NEB) to anaphase onset (AO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Microbiology 2022Quote: ... and amplicons were generated by PCR (primers 341F and 806R) using a Phusion High-Fidelity PCR Master Mix (New England Biolabs). Amplification product quality was assessed by gel electrophoreses and samples were pooled in equimolar ratios ...
-
bioRxiv - Genomics 2020Quote: ... 2.5uL reverse PCR primer (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT) and 25uL NEBnext High-Fidelity 2x PCR Master Mix (New England Biolabs, MA, United States)) using thermo-cycler conditions described in 94 for a total of 9 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Bioengineering 2019Quote: VIM-T2A-mCardinal sequence was cloned from cDNA of knocked-in cells upon PCR amplification into linearized by PCR pmR expressing vector (Clonetech) and recombined using Gibson Assembly reagent (NEB). Resulting vector contained full VIM-T2A-mCardinal reading frame under the control of CMV promoter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... of HIV env was amplified using a nested PCR approach with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The outer primers were ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs M0531) and PCR cycling at 98°C for 30s ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 20 uL 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and using touchdown PCR cycling at 98°C for 30s ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then amplified by PCR using custom nextera primers at 400 nM and NEBNext HiFi 2x PCR Master Mix (New England Biolabs) (Buenrostro et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).
-
bioRxiv - Microbiology 2022Quote: ... DNA library was prepared by PCR amplification using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs). The resulting PCR products were purified by QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs); 0.2 μM each of forward and reverse primers ...
-
bioRxiv - Microbiology 2020Quote: ... Eluted cDNA was transferred to a new PCR tube containing 15 μL of 2X Phusion HF-PCR Master Mix (NEB), 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... The resulting PCR products were used in a PCR to add Gateway attB sites: 25 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 µL PCR product ...
-
bioRxiv - Immunology 2022Quote: All CER constructs were generated by standard PCR cloning techniques and the PCR products were assembled using the NEBuilder HiFi DNA Assembly (New England Biolabs). CER21 was generated by linking the extracellular and transmembrane domain of human TIM-4 (GenBank™ accession number AAH08988.1 ...
-
bioRxiv - Genetics 2019Quote: ... and joined in a single step by overlap extension PCR (1st step: equimolar mix of PCR fragments ZEO, HR and HL, NEB Q5 high-fidelity 2X master mix ...
-
bioRxiv - Immunology 2019Quote: ... TCR amplification was achieved by performing two rounds of nested PCR using Phusion High-Fidelity PCR Master Mix (New England Biolabs). During the first PCR priming ...
-
bioRxiv - Genomics 2019Quote: ... 128 ng of this mixture was used per PCR with NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) along with the reverse-transcriptase primer (Creb_Hand_RT ...
-
bioRxiv - Genomics 2019Quote: ... This volume was distributed across 14 replicates per technical replicate so as to not exceed 10% of the total PCR volume and amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) with the primers P5_Seq_Luc_F and P7_Ind_##_Han ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Cell Biology 2021Quote: Site-directed mutagenesis of pLenti-CMV-Neo-PINK1 (C125G)-EYFP or pLVX-puro-OMA1 (E328Q)-EYFP was performed by PCR amplification (CloneAmp HiFi PCR Premix, Takara or Q5 High-Fidelity DNA Polymerase system, NEB) of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system ...
-
bioRxiv - Cell Biology 2021Quote: ... 319 bp and 201 for the heterozygous vclb mutants and PCR products of 490 bp and 319 bp for homozygous vclb mutants PCR was performed using OneTaq DNA polymerase (NEB) and PCR products were loaded on a 1% agarose gel to assess the genotype (see Supplementary Figure 2).