Labshake search
Citations for New England Biolabs :
751 - 800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... mCherry-2-L and the PIF5 coding sequence into pJHA212G80 containing the rbcS terminator using Gibson Assembly (New England Biolabs, Ipswich, MA). The resulting construct was transformed into pif5-3 using Agrobacterium-mediated transformation ...
-
bioRxiv - Physiology 2024Quote: ... After the PCR 20ul of the PCR product were restriction digested with BamH1 (NEB #xxx) for 1 hr at 37C ...
-
bioRxiv - Physiology 2024Quote: ... Double stranded RNA was synthesized by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Whitby, ON, Canada) following manufacturers recommendations ...
-
bioRxiv - Physiology 2024Quote: ... Samples were then thawed at room temperature and total RNA was isolated using the Monarch Total RNA Miniprep Kit following manufacturers protocol with an on-column DNase treatment to remove genomic DNA (New England Biolabs, Whitby, ON, Canada). Purified total RNA samples were subsequently aliquoted onto a Take3 micro-volume plate and quantified on a Synergy Multi-Mode Microplate Reader (BioTek ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.002 U thermostable inorganic pyrophosphatase (NEB); 0.15-0.3 µg template ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequencing libraries were prepared using the Directional RNA Library Prep Kit (E7760S, New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... and first strand cDNA was synthesized with One-Taq RT-PCR kit (New England Biolabs), according to manufacturer’s protocols ...
-
bioRxiv - Physiology 2024Quote: RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) according to manufacturer’s polyA mRNA workflow at the Advanced Analysis Center at the University of Guelph (Guelph ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNA-seq libraries were constructed using the NEBNext® Ultra™ RNA Library Prep Kit according to the manufacturer’s recommendation for Illumina® (NEB, USA). The library quality was assessed using the Agilent 2100 Bioanalyzer system ...
-
bioRxiv - Neuroscience 2024Quote: ... the supernatant was applied on a pre-equilibrated chitin matrix (New England Biolabs) and incubated 1.5 h at 4°C under shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 of α2-3,6,8,9 Neuraminidase A (New England Biolabs, Fig. 2d and Extended Data Fig. 2a,b) were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× PNGase F buffer (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL of RNase H (5,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× RNase H buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 1 µL of nuclease P1 (100,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× TURBO DNase buffer or nuclease P1 buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ul of 10x Template Switching Reverse Transcriptase (New England Biolabs, MA, USA) for the synthesis of the 1st strand ...
-
bioRxiv - Molecular Biology 2024Quote: ... USA) for the synthesis of the 2nd strand were used following manufacturer user manual instructions (TakaraBio, USA; New England Biolabs, MA, USA). The synthesized dscDNA was purified using SPRI AMPure beads according to manufacturer’s dscDNA was purified using SPRI AMPure beads ...
-
bioRxiv - Neuroscience 2024Quote: ... Subcloning PCR product and pEGFP-C1 backbone were cut using Kpn1-HF and Spe1-HF restriction enzymes (New England BioLabs) and ligated using Quick Ligase Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and ligated using Quick Ligase Kit (New England BioLabs) according to manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2024Quote: ... myrDendra2-Actb5’UTR3’ subcloning into pEGFP-C1 vector (dendra2-C1) was performed with restriction enzyme cloning using NEBNext Ultra II Q5 Master Mix (New England BioLabs) using the following primers ...
-
bioRxiv - Neuroscience 2024Quote: ... following linearization of the vector through restriction enzyme digestion using AgeI-HF (NEB) and SalI-HF (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µM FeSO4 and 1 µl murine RNase inhibitor (NEB). The products of the reactions were digested to nucleosides and analyzed by LC-MS/MS ...
-
bioRxiv - Neuroscience 2024Quote: ... and SalI-HF (NEB). Cloning was done using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... 2μL of RNase 1f (New England Biolabs) was added to samples and incubated at room temperature for 45 minutes under gentle agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... The NEBNext Ultra End Repair/dA-tailing Module (New England Biolabs; Ipswich, MA) was used for end repair and A-tailing of the isolated ...
-
bioRxiv - Neuroscience 2024Quote: ... Cloning was done using Gibson Assembly Master Mix (NEB) and the resulting products were cleaned up using SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... or amylose resin (NEB). The in vitro phosphorylation assay was performed using proteins purified from maize seedlings or protoplasts or 2 µg recombinant proteins as kinases and 5-10 µg universal substrate MyBP or recombinant proteins as substrates ...
-
bioRxiv - Neuroscience 2024Quote: ... purified ∼25−50-nt RNA fragments underwent treatment with recombinant shrimp alkaline phosphatase (New England Biolabs; M0371) to remove 5’-and 3’-phosphates ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragments were re-phosphorylated at their 5’-hydroxyl groups using T4 polynucleotide kinase (New England Biolabs; M0201S) and purified using the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... was followed by PCR amplification using Phusion high-fidelity DNA polymerase (New England Biolabs; M0530S) for 15 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Neuroscience 2024Quote: ... CUT&RUN libraries were made using the NEB Ultra II DNA Library Prep Kit for Illumina (NEB E7645L), and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 µL T4 PNK (NEB Cat#M0201), and 0.5 µL RNasIN (Promega Cat#N2511 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by DNaseI treatment of the RNA for 10 min at 37°C (New England Biolabs, M0303), and removal of the DNaseI using the RNA clean up kit (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... and removal of the DNaseI using the RNA clean up kit (New England Biolabs, T2040). For the RNA quantification ...
-
bioRxiv - Microbiology 2024Quote: ... a Q5 high fidelity DNA polymerase (New England Biolabs, M0491), and 10 µM forward and reverse gene specific primers containing an additional UMI sequence (8 random nucleotides ...
-
bioRxiv - Microbiology 2024Quote: ... followed by DNaseI treatment of the RNA for 10 min at 37°C (New England Biolabs, M0303), and removal of the DNaseI using the RNA clean up kit (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... was mutated by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs, E0554). To assemble full JcDV genomes after site directed mutagenesis ...
-
bioRxiv - Microbiology 2024Quote: ... for cellular genes or the Luna universal probe qPCR Master Mix (New England Biolabs, M3004) for the viral transcripts ...
-
bioRxiv - Microbiology 2024Quote: ... using the Luna universal qPCR Master Mix (New England Biolabs, M3003) for cellular genes or the Luna universal probe qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...
-
bioRxiv - Microbiology 2024Quote: ... 72°C: 1’0 min) with a Q5 high fidelity DNA polymerase (New England Biolabs, M0491) and 10 µM forward gene specific primers also containing an additional UMI sequence (8 random nucleotides ...
-
bioRxiv - Microbiology 2024Quote: ... Cellular genes were amplified by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs) after DNA extraction (Quick-DNA Miniprep Kit ...
-
bioRxiv - Microbiology 2024Quote: ... and removal of the DNaseI using the RNA clean up kit (New England Biolabs, T2040).