Labshake search
Citations for New England Biolabs :
901 - 950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Restriction and cloning enzymes were obtained from New England Biolabs (NEB). Unless stated otherwise ...
-
bioRxiv - Cell Biology 2024Quote: ... 1X T4 Ligase (NEB, M0202)) overnight at 4°C in dark humidity chamber followed by proximity ligation assay between biotin and protein of interest.
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were then inverted onto a 50μL drop on parafilm of Ligation Reaction (0.1μM DI-PLA Linker, 1X T4 Ligation Buffer (NEB, B0202), 1mM ATP ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by the GFP sequence were generated by using the HiScribe T7 ARCA mRNA Kit (New England Biolabs, E2060). 1 µg mRNA was first denatured at 65°C for 3 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared as in [34] with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB).
-
Dissecting the dynamics of coordinated active transcriptional repression in a multicellular organismbioRxiv - Molecular Biology 2024Quote: ... 2 mM vanadyl-ribonucleoside complex (New England Biolabs), and 10.6% dextran sulfate (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The resulting PCR products were then ligated into the EcoRI/KpnI sites of the pCM29-sgfp vector using the ClonExpress II One-Step Cloning Kit (Vazyme) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA sequencing libraries were created using the NEBNext mRNA stranded protocol (New England Biolabs) and 100 base paired-end sequencing was performed on an Illumina NovaSeq 6000 (McGill University and Genome Quebec Innovation Centre) ...
-
Dissecting the dynamics of coordinated active transcriptional repression in a multicellular organismbioRxiv - Molecular Biology 2024Quote: ... coli tRNA (New England Biolabs), 15% formamide (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of Luna® Universal qPCR Master Mix (Biolabs, Ipswich, MA, USA) and 2 μl from 1:20 diluted cDNA template.
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using primers containing the homology arm flanking the sgRNA region (replacing the BRD4 homology arm) and Gibson cloned (NEBuilder Hifi DNA assembly kit, NEB) into the same vector by digesting with MluI restriction enzyme.
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.2 µM of each primer were amplified with 0.5 units of One Taq DNA polymerase (Biolabs, Ipswich, MA, USA). Cycling conditions were established with an initial denaturation step at 95°C/2 min followed by 40 cycles at 95 °C/45 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of DNA template in 25 µl of 1x One Taq Standard Buffer (Biolabs, Ipswich, MA, USA), 0.2 mM dNTPs ...
-
bioRxiv - Cancer Biology 2024Quote: ... CUT&Tag libraries were prepared with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and indexed primers (Buenrostro et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA was treated with DNase (NEB) and purified using the RNA Clean and Concentrator kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was isolated from different tissue (7dpf larvae, adult brain, oocytes and ovary) using Trizol (NEB) and purified using the RNA Clean and Concentrator kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used for in-vitro transcription using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... For lambda phosphatase (New England BioLabs, P0753S) treatment ...
-
bioRxiv - Microbiology 2024Quote: ... All LAMP reactions were conducted in the WarmStart® Colorimetric LAMP Master Mix (NEB Canada, Whitby, ON). Each 20-µ L reaction contained 2 µ L of template ...
-
bioRxiv - Molecular Biology 2024Quote: ... to enrich mRNA and the Ultra II Directional RNA Library Prep Kit (NEB, Cat# E7760) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was achieved using the NEBNext rRNA depletion kit v2 (NEB, Cat# E7400L), and subsequent end-repair ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation utilized the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB Cat# E7300/7580) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Then the PCR amplicon of Cdk1 CpG was digested by KpnI and MfeI (New England Biolabs) to remove the overhangs ...
-
bioRxiv - Cell Biology 2024Quote: ... orthovanadate (200 nM; New England Biolabs, P0758S) and β-glycerophosphate (25 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were first incubated with Deglycosylation Mix Buffer 2 (NEB) at 75°C for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Extracted RNA fragments were first treated with T4 Polynucleotide Kinase (T4 PNK, NEB, M0201L) without adding ATP to remove the 3’ end phosphates ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) with P5 primer (AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNAGGGCGGCAAGATCGCCG TG ...
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction or gBlock synthesis (IDT) and assembled using HiFi assembly (New England Biolabs) according to the manufacturer’s instructions as shown in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Restriction enzymes were from New England BioLabs (NEB) and DNA ligations were performed using the Rapid DNA Ligation kit (Roche).
-
bioRxiv - Microbiology 2024Quote: ... or Phusion polymerase (NEB).
-
bioRxiv - Microbiology 2024Quote: ... ligated into the pSIE1 vector via Gibson assembly (New England Biolabs), and conjugated into Bt via E ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA depletion was performed using the NEBNext rRNA Depletion Kit for Bacteria (New England Biolabs), spiked with a custom oligo pool ...
-
bioRxiv - Microbiology 2024Quote: ... libraries were prepared using the NEBNext® Ultra™ Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... in comparison to low molecular weight ssRNA (NEB #N0364S). Gels were cut on a blue light box corresponding to the size of tRNAs (70 to 100 nt ...
-
bioRxiv - Microbiology 2024Quote: ... samples were PCR amplified using HF Phusion enzyme (NEB #M0530L) (2 μl of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNase-treated total RNA was further treated with RNA 5’ Pyrophosphohydrolase (New England Biolabs) to remove possible pyrophosphate from the 5’ end ...
-
bioRxiv - Microbiology 2024Quote: All PCR reactions were performed using Phusion HF polymerase (New England Biolabs). All oligonucleotides were purchased from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA libraries were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Libraries of small RNA were constructed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England BioLabs, #E7330) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... or Induro (NEB #M0681L) reverse transcriptases ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries for ribosome profiling were prepared following the NEBNext Multiplex Small RNA Library Prep kit for Illumina’s protocol (NEB, Cat# E7300S). Ribo-seq ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by end repair with T4 Polynucleotide Kinase (T4 PNK; NEB, Cat# M0201) at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... the lentiCRISPR-v2 vector was digested by BsmBI-v2 (NEB, Cat# R0739L) and dephosphorylated by Quick CIP (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... ribosome foot-printing involved the addition of 1.25 U/μL RNase I (NEB Cat# M0243L) to 500 μL clarified lysate ...
-
bioRxiv - Molecular Biology 2024Quote: ... with NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The details of plasmids source and usage are listed in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... while library concentration was determined using the NEBNext Library Quant Kit for Illumina (NEB, Cat# E7630). All input RNA had RNA integrity number (RIN ...