Labshake search
Citations for New England Biolabs :
9651 - 9700 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... DNA segments exceeding 1 kb in length were manually excised from the agarose gel and retrieved using a Monarch® DNA Gel Extraction Kit (NEB Inc., USA). A Qubit 2.0 Fluorometer and the Qubit (ds)DNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... These PCR products were inserted into EcoRI-XhoI-digested linearized pCAGGS using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Ipswich, MA, USA). Previously constructed plasmids expressing G of VSBV-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The two fragment products of rpfF and the linearized pK18mobsacB (Schäfer et al. 1994) were then isothermally assembled using the Gibson cloning kit (NEB; Gibson et al. 2009) following the manufacturer’s instructions in a 5:1 insert to backbone ratio ...
-
bioRxiv - Molecular Biology 2024Quote: ... The precipitated DNA was washed once with 70% ethanol and suspended in 30μl 0.1 X TE (1mM Tris-HCl and 0.1mM EDTA) for library preparation with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB # E7645S) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... high molecular weight (HMW) DNA was extracted from an overnight culture using the Monarch HMW DNA Extraction Kit for Tissue (New England Biolabs, Ipswich, MA, USA) as per manufacturer’s protocol for HMW DNA extracted from bacteria ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 5 ng of the resulting RNA was applied for library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New Englands Biolabs).
-
bioRxiv - Developmental Biology 2024Quote: ... and the sgRNA was synthesized in vitro as described in the manual (HiScribe™ T7 High Yield RNA Synthesis Kit, NEB, NO. E2040S), the sgRNA and Cas9 protein were mixed and coinjected into the cell cytoplasm at the one-cell stage ...
-
bioRxiv - Developmental Biology 2024Quote: ... dilution of the universal adaptor and 13 cycles (or 16 cycles) of PCR per the respective masses with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Cat. No. E7760L), the NEBNext Poly(A ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A library was then prepared following the NEBNext Ultra II Directional RNA Library Prep for Illumina Kit procedure (New England Biolabs, Ipswich, MA, USA). A library was directly prepared from 100 ng of total RNA extracted from floral buds using the NEBNext Ultra II Directional RNA Library Prep for Illumina Kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was submitted for small RNA sequencing to the UT Southwestern McDermott NGS Core using the NEBNext Small RNA kit (New England Biolabs, cat. no. E7330), with size selection between 15bp and 30bp ...
-
bioRxiv - Cell Biology 2024Quote: ... a total amount of 1 µg RNA per sample was used as input material for the RNA sample preparations and sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA).
-
bioRxiv - Cell Biology 2024Quote: ... to pull down mRNA and used for cDNA library construction using NEBNext ultra II directional RNA library prep kit for Illumina as recommended by the manufacturer (New England Biolabs, Inc, Ipswich, MA). The quality of the cDNA libraries were assessed on the TapeStation (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons prepared for long-Illumina read sequencing (PE300) underwent end repair with NEBNext® End Prep Ultra II Kit (Supplemental Table 9, Cat No. E7645, NEB, Ipswich, MA). Custom iTru adapters were ligated to amplicons with NEBNext® Ultra II Ligation Master Mix with a 15 min incubation at 20°C (Supplemental Table 6) ...
-
bioRxiv - Genomics 2024Quote: ... 5 μg of HMW DNA sample was fragmented by sonication to a size of 350 bp and sequencing library was prepared using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs, USA) following manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified ChIP DNA and 220 ng of whole cell extract DNA were used to prepare ChIP-seq libraries using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB, E7645S) with PCR amplifications carried out for 16 cycles ...
-
bioRxiv - Genomics 2024Quote: DNA libraries were constructed using the NEBNext Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reversely transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end repaired ...
-
bioRxiv - Genetics 2024Quote: To determine the T-DNA insertion site of line ClvRubq7 we extracted genomic DNA from two different plants and constructed sequencing libraries using NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB #E7805) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were prepared using a NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, UK). Each library was deep sequenced on an Illumina NovaSeq to generate 30 Gbp of data per sample (100 million paired-end 150 reads ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for sequencing were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs, #E7645L) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries for RNA-Seq were constructed using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB, E7760), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional Library Kit with the oligo-dT magnetic isolation module (New England Biolabs, Ipswich, MA, USA) and sequenced on the Illumina NovaSeq 6000 platform at the Genomic Sciences Laboratory at North Carolina State University to generate a minimum of 40M read pairs (2x150bp ...
-
bioRxiv - Pathology 2024Quote: ... 500 ng of total RNA from each sample were used as input for library preparation with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs; Ipswich, MA, USA), following manufacturer’s recommendations for Poly(A ...
-
bioRxiv - Microbiology 2024Quote: The first step in BYDV detection was to extract the total RNA from individual aphid and plant samples using a Monarch Total RNA Miniprep Kit (NEB, Ipswich, MA, USA) as described elsewhere (Chirgwin et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... The poly(A) mRNA-enriched libraries were constructed using NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs, Ipswich, MA). Sequencing was performed using an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Plant Biology 2024Quote: ... The sequencing library of each sample was constructed from the amplified mRNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs, USA) according to the user guide ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... FYVE-mApple-SmBiT was constructed by inserting SmBiT into pmApple-N1 at the C-terminus of mApple using the Q5 site directed mutagenesis kit (NEB M0492 and M0054) and then inserting the FYVE domain from FYVE-LgBiT at the N-terminus of mApple ...
-
bioRxiv - Neuroscience 2024Quote: ... The rRNA-depleted RNA was converted [15] into Illumina-compatible DNA libraries via the NEBNext® Ultra™ II Directional RNA Library Prep with Sample Purification Beads kit (NEB# E7765) using the manufacturer’s protocol for use with rRNA-depleted RNA and NEBNext® Multiplex Oligos for Illumina® (NEB# E6448) ...
-
bioRxiv - Developmental Biology 2024Quote: ... dilution of the universal adaptor and 12-16 cycles of PCR per the respective masses with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Cat. No. E7760L), the NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2024Quote: ... and cloning them into the HindIII and NotI sites of the pCS2-Flag vector using the Gibson Assembly® Cloning Kit (New England Biolabs, catalog #E5510S). The mDmrta2 Mut C-R mutant was generated similarly by amplifying two fragments encoding the N-terminal and C-terminal region of Dmrta2 using primers 5’-CATTCTGCCTGGGGACGTCGGAGC-3’ and 5’-CTTCTCCGCTGCCCTCAACAGCAG-3’ for the N-terminal region ...
-
bioRxiv - Microbiology 2024Quote: ... Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reversely transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end repaired ...
-
bioRxiv - Cancer Biology 2024Quote: ... 800ng RNA was used per sample as input for the RNA library preparation using NEBNext® rRNA Depletion Kit v2 (NEB, E7405L, USA) and NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... This RNA was used to generate cDNA libraries for each sample using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). Primers that bind to the beginning and end of the BsAUX/IAA16 gene (Table S7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... selection and cDNA libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs Inc., Massachusetts, USA). The final library size was approximately 430 bp with an insert size of approximately 300 bp ...
-
Positive impact of Type-A and -C response regulator genes on growth and panicle architecture in ricebioRxiv - Plant Biology 2024Quote: ... The enriched mRNA was fragmented into short fragments using fragmentation buffer and reverse-transcribed into cDNA using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end-repaired ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA for RNA sequencing was extracted from the punched tissue using a Monarch Total RNA Miniprep Kit (T2010S, New England Biolabs, Inc., Massachusetts, USA), and sequencing was outsourced (NIPPON Genetics Co. ...
-
bioRxiv - Plant Biology 2024Quote: ... The poly(A) mRNA-enriched libraries were constructed using NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs, Ipswich, MA). Paired-end sequencing (2×150 bp ...
-
bioRxiv - Neuroscience 2024Quote: ... Transcriptomic profiling of the VS samples was based on an NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) that was used for library preparation after rRNA depletion ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs E7760S) and paired end sequencing was performed on the Nextseq 500 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... DNaseI-treated 1 µg RNA aliquots were immediately used in cDNA synthesis and no-reverse transcriptase control (no-RT) reactions with random primers (New England BioLabs Protoscript II kit).
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-seq libraries were prepared in three biological replicates from 1ug of total RNA using NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (E7770, NEB) together with NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2024Quote: ... was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Plant Biology 2024Quote: ... and Illumina sequencing libraries were prepared using NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB, cat. No. E7770), 24 libraries were pooled and sequenced on Illumina HiSeq4000 in 50 bp single-end (SE ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used as templates for in vitro transcription (IVT) reaction by the T7 promoter using T7 polymerase and the HiScribe T7 High Yield RNA Synthesis kit (NEB, cat. no. E2040L). Template DNAs were removed by treating with DNase I at 37°C for 30 minutes and the IVT RNAs were further purified by RNA purification kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Template DNAs were removed by treating with DNase I at 37°C for 30 minutes and the IVT RNAs were further purified by RNA purification kit (NEB, cat. no. T2040L). The size of each IVT RNA was also confirmed by agarose gel electrophoresis ...
-
bioRxiv - Genomics 2024Quote: ... Input and CHART DNA libraries were prepared according to the protocol of the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB E7645S). Libraries were sequenced on Novaseq S4 ...
-
bioRxiv - Immunology 2024Quote: ... Bulk RNA sequencing libraries were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Cat-no. E7765) and sequenced on an Illumina NextSeq 500 instrument.
-
bioRxiv - Bioengineering 2024Quote: ... was used for construction of libraries by means of the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, USA). KAPA UDI Primer Mixes (KAPA biosystems ...