Labshake search
Citations for New England Biolabs :
9601 - 9650 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Polyadenylated RNA enrichment and library preparation were conducted using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7490S and #E7760S), respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequencing libraries were generated using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (E7770, New England BioLabs, Ltd., USA) by the Beijing Allwegene Technology Company Limited (Beijing ...
-
bioRxiv - Bioengineering 2024Quote: ... Synthetic RNA was generated through in vitro transcription of gene fragments using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) and quantified via qPCR standard curve.
-
bioRxiv - Microbiology 2023Quote: ... A second PCR purification was performed prior to insertion of the Ultramers into the vector by DNA assembly with the NEBuilder HiFi DNA Assembly Kit (NEB, Cat. No. E2621). Next ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was fragmented and TruSeq-Adapters ligated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina® (NEB) and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μl of which were transferred to a new tube and subjected to a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB #E7645), using half of the recommended reagents’ volumes ...
-
bioRxiv - Molecular Biology 2022Quote: ... AGTCCCCAGCACATAGAAGG hWISP1_negative_reverse: GGTTCTGAAGGTGACCGACT ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3-TNFR1 expression vector was generated by cloning with the primers indicated below to PCR amplify (using Q5 High-Fidelity PCR kit, New England Biolabs, Euroclone, Milan, Italy) the TNFR1 reference sequence from pBMNZ-neo-Flag-TNFR1 L380A (gift from Martin Kluger ...
-
bioRxiv - Cancer Biology 2022Quote: ... and bar-coded libraries were constructed using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich MA). Libraries were pooled and sequenced single-end (1×75 ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions to generate catalytic arginine point mutants for AIM18 and AIM46 were performed according to the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Table S2). SDM reactions were transformed into E ...
-
bioRxiv - Bioengineering 2022Quote: ... RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, Ipswich, MA) and then column purified ...
-
bioRxiv - Biochemistry 2022Quote: ... The two pairs of PCR products were ligated together by in vitro homologous recombination using a Gibson assembly cloning kit (NEB, Boston, MA, USA), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... full-length human MYO5 was cloned from the same cDNA library as above and inserted into the pHTN-HaloTag expression vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA synthesis was performed as a 20 μl reaction using the LunaScript® RT SuperMix Kit (NEB, following the manufacturer’s protocol) and cDNA was stored short-term at −20°C before transcriptional assessment.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Total RNA samples were subjected to library preparation using an NEB Next Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol (NEB #E7530) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared from 100 ng of DNA using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB E7805L) with NEBNext® Multiplex Oligos for Illumina® (E7600S) ...
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Microbiology 2022Quote: Meta3C sequencing libraries were generated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB catalogue number #E6177) following the manufacturer’s protocol with barcoding of the MluCI and HpaII libraries with the NEBNext® Multiplex Oligos for Illuminia® (NEB #E7335) ...
-
bioRxiv - Microbiology 2022Quote: ... USA) containing the desired sequences were first cloned into pKD3 or pKD4 (contain R6Kγ origin) using Gibson Assembly (NEB Gibson Assembly Cloning Kit) and maintained in PIR1 E ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... Transcription-unit (TU) plasmids were assembled with promoters and terminators from the MoClo kit using high-fidelity BsaI restriction enzyme (NEB, Ipswitch, MA, USA)51 ...
-
bioRxiv - Microbiology 2023Quote: ... and metagenomic libraries were prepared using 50 ng of DNA and the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Ipswich, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: ... PCR amplified fragments were assembled with BamHI and SbfI linearized pUA139 using the NEBuilder HiFi DNA Assembly kit (New England Biolabs Inc., MA, USA) to generate pTE24G ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA; E11.5 samples) and the TruSeq stranded mRNA Library prep (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and one short read library using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England BioLabs Inc., Ipswich, MA, USA). The long-read library was then sequenced on the PacBio Sequel IIe system in CLR mode using the Sequel II Binding Kit 2.2 (PacBio) ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 viral RNA detection and quantification was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Whitby, ON, Canada) on the Rotor-gene Q platform (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The library preparation of the total RNA was performed with the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420S/L). Single read sequencing with a read length of 72 bp was performed on NextSeq ® 2000 System using the corresponding NextSeq2000 P3 Reagent Kit (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... A strand-specific RNA sequencing library was prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA). Then ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sequencing libraries were generated with about 330ng DNA and the NEBNext Ultra II FS DNA Library Prep Kit in combination with NEBNext Multiplex Oligos (New England Biolabs, Ipswich, MA, USA). We sequenced 2×125bp reads with an Illumina HiSeq 2500 at the VBCF-NGS facility (https://www.viennabiocenter.org/vbcf/next-generation-sequencing/) ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then processed following the NEB Monarch HMW DNA extraction kit for cells and blood (New England Biolabs, Ipswich, MA, Cat#T3050L).
-
bioRxiv - Microbiology 2023Quote: ... using the NEBNext Ultra II Directional RNA Library Prep Kit and the NEBNext Multiplex Oligos for Illumina (New England BioLabs, Ipswich, MA, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted into 750 uL TRIzolTM LS and libraries were prepared using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, version 3.0, #E6420L) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 ...
-
bioRxiv - Genomics 2022Quote: ... The successful amplification of a COI gene fragment of approximately 680 bp was confirmed by agarose gel electrophoresis before the amplicon was purified with the DNA Cleanup Kit (New England Biolabs, Ipswich, MA, USA) and sequenced (Eurofins Genomics ...
-
bioRxiv - Cell Biology 2023Quote: ... The ChIP and evDNA were purified and used for constructing sequencing libraries with a NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). The library quantifications were assessed on the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Immunology 2023Quote: ... Libraries from purified progenitor RNA were generated using the NEBnext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Ipswitch, MA, USA). rRNA depleted RNA was fragmented ...
-
bioRxiv - Genomics 2023Quote: ... Further amplification was achieved by in-vitro transcription that was performed overnight using a high-yield in vitro transcription kit (NEB, cat. no. E2050S). Reverse transcription was then performed on the RNA template using Maxima H-Reverse Transcriptase (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... The resulting cDNA was sent to Biotools Co., Ltd (New Taipei City, Taiwan) for library preparation using the NEBNext® DNA Library Prep Kit (NEB, USA,20015828,20015829), and sequenced for 150bp paired-ends on an Illumina Hiseq 2500 sequencer ...
-
bioRxiv - Genomics 2023Quote: ... Libraries of the fragmented DNA were prepared with the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, USA) according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2023Quote: ... RNA synthesis was conducted via in vitro transcription using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, NEB, Ipswich, MA). After DNase I (RNase-free ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries for RNA-Seq were prepared with NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England BioLabs, USA) for three replicates per treatment resulting in 24 libraries with a mean insert size of 300 bp ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis of ATG8-Interacting Motifs (AIM) was performed using Q5 site-directed mutagenesis kit (New England BioLabs, Frankfurt am Main, Germany) using primers listed in Supplemental Table S5 according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The purified DNA was amplified for high-throughput sequencing by an Ultra II DNA Library Prep Kit (New England Biolabs, Catalog Number: E7645S). Then ...
-
bioRxiv - Genomics 2024Quote: ... 5 ng of the resulting RNA was applied for library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New Englands Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was submitted for small RNA sequencing to the UT Southwestern McDermott NGS Core using the NEBNext Small RNA kit (New England Biolabs, cat. no. E7330), with size selection between 15bp and 30bp ...
-
bioRxiv - Genetics 2024Quote: To determine the T-DNA insertion site of line ClvRubq7 we extracted genomic DNA from two different plants and constructed sequencing libraries using NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB #E7805) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 5 μg of HMW DNA sample was fragmented by sonication to a size of 350 bp and sequencing library was prepared using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs, USA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently used to assemble the RNA-seq library using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB; E7760), according to the manufacturer’s protocol ...