Labshake search
Citations for New England Biolabs :
9651 - 9700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the XhoI site in the original construct was replaced with an MluI site using Q5 site directed mutagenesis (New England Biolabs) using primers ...
-
bioRxiv - Microbiology 2023Quote: ... A set of Gibson Assembly (New England Biolabs, Inc.) primer pairs (RicT-F2 and RicT-R2 ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into pTM1 (a pDONR/Zeo based plasmid) downstream of the ACT1 promoter using Gibson cloning kit (NEB), and then introduced into pDG33 using Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: Libraries for RNAseq were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). Individual libraries were uniquely barcoded with NEBNext Multiplex Oligos for Illumina sequencing platform (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP-seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) and sequenced on the Illumina NovaSeq 6000 Sequencer (2×150 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using Monarch PCR/DNA Cleanup Kit (New England BioLabs). ChIP-seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... or the NEBNext Single Cell/Low Input RNA Library Prep Kit (New England Biolabs, Ipswich, MA) (corpuscles samples) ...
-
bioRxiv - Genetics 2023Quote: PCR was performed using OneTaq polymerase (NEB #M0480). Reactions consisted of 1X OneTaq Standard Reaction Buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... NEBNext Multiplex Oligos for Illumina (E7600, New England BioLabs, Ipswich, MA), home-made SPRI beads (Rohland and Reich 2012 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Gibson Cloning kit (New England Biolabs). The protocol is available here dx.doi.org/10.17504/protocols.io.j8nlkkzo6l5r/v1 ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST fusion proteins or amylose resin (New England Biolabs #E8021S) for MBP fusion proteins for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The mixtures were diluted into 400 µl of Binding Buffer and then incubated with the appropriate resin (amylose for MBP, New England Biolabs # E8021S ...
-
bioRxiv - Cell Biology 2023Quote: ... All sequences were inserted into L4440 using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into DH5a bacteria ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of DNA was done using Q5 High-Fidelity DNA polymerase (NEB) and clones obtained were confirmed by sequence analysis.
-
bioRxiv - Microbiology 2023Quote: ... Each fragment was amplified by PCR using the Q5® High-Fidelity DNA Polymerase (NEB, Cat #: M4091L) following the manufacturers protocols ...
-
bioRxiv - Microbiology 2023Quote: Reporter fusions of sRNA targets were in-vitro translated in the absence and presence of sRNA using the PURExpressⓇ In Vitro Protein Synthesis kit (NEB). Four picomoles of in-vitro transcribed 5’UTR reporters (including the RBS/sRNA interaction site and the first 10 codons of flgM ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were dephosphorylated with Antarctic Phosphatase (NEB), 5’ end-labeled (γ32P ...
-
bioRxiv - Microbiology 2023Quote: ... Vector and insert were ligated overnight at 16°C using T4 DNA ligase (New England Biolabs) and transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Bioengineering 2023Quote: ... T4 Ligase and low molecular-weight DNA ladder were obtained from New England Biolabs (NEB). Methyltetrazine DBCO ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Bioengineering 2023Quote: ... or NEB Stable (NEB cat. no. C3040) E ...
-
bioRxiv - Bioengineering 2023Quote: NEB Turbo (NEB cat. no. C2984), NEB 10-beta (NEB cat ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were assembled using the HiFi DNA Assembly kit (NEB, cat #E2621) from degenerate UltramerTM oligos (IDT) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were constructed using scarless assembly reactions to insert oligos into plasmid backbones (BbsI-HF-v2, 1X T4 DNA ligase buffer, T4 DNA ligase; NEB). For amino acids with six synonymous codons (leucine ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Discrete strains were assembled using the HiFi DNA Assembly kit (NEB, cat #E2621) from IDT gBlocks ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Discrete plasmids were constructed using the HiFi DNA Assembly kit (NEB, cat #E2621) to insert synthetic genes (IDT gBlocks or eBlocks ...
-
bioRxiv - Plant Biology 2023Quote: ... Site directed mutagenesis of MLO2CT was performed by Gibson assembly (Gibson et al. 2009) based on suitable PCR fragments generated with Phusion® high-fidelity DNA polymerase (NEB GmbH, Frankfurt, Germany). The CAM2 coding sequence was inserted as an NcoI/XhoI DNA fragment into modified pET28a vector that lacks the N-terminal His6 tag (previously designated pETλHIS ...
-
bioRxiv - Plant Biology 2023Quote: ... using Phusion DNA polymerase (NEB) and the primers (FOR 5’CTTAATTAATTAAAAGACAACAACGACCTGAATCT3’ and BACK 5’ CATGGCGCGCCCTCGAGGCCTCTTTTTACCATGTTG3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... which was accomplished by using micrococcal nuclease (MNase, New England Biolabs) instead of sonication.
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and T4-DNA Ligase (both NEB). In level 1 and 2 plasmids the cloning site for the ORF disrupts the mCherry gene ...
-
bioRxiv - Plant Biology 2023Quote: ... with the native ACO2 promoter using Gibson Assembly® (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cas9 expression vector by golden-gate assembly with BbsI-HF (New England Biolabs, R3539L)33,34 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coli (New England Biolabs, Cat. #C3040H) was transformed with 2 μL of each ligation reaction and resulting colonies were selected for plasmid DNA isolation using the ZymoPure Plasmid miniprep kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: ... the difference sequences were assembled using NEBuilder HiFi DNA Assembly (New England BioLabs, E2621). For BiTE molecules ...
-
bioRxiv - Microbiology 2023Quote: ... 0.37 U murine RNase inhibitor (NEB) and 0.69 μM ModB at 15 °C ...
-
bioRxiv - Genetics 2023Quote: ... and adaptor ligation (New England BioLabs). The final products were TA cloned and analyzed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Constructs were made using Gibson Assembly (NEB Inc., MA) and confirmed by sequencing ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by reverse transcription using Protoscript II (New England Biolabs, M0368L) and circularization of cDNA using CircLigase ssDNA Ligase (Epicenter ...
-
Deletion of MEC1 suppresses replicative senescence of the cdc13-2 mutant in Saccharomyces cerevisiaebioRxiv - Molecular Biology 2023Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, cat. no.: E0554S). The mutations were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Systems Biology 2023Quote: ... coli cells (New England Biolabs). Protein expression was induced at OD600 nm 0.6 - 0.8 with 1 mM IPTG overnight at 18°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and BlpI (R0585S, NEB) restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... coli strain (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... Gαi2R179C and GαoAR243H mutants were constructed using pcDNA3.1 wild-type human ee-tagged-Gαi2- and ee-tagged-GαoA plasmids as template (cDNA Resource Center) and Q5 Site-directed mutagenesis kit (New England BioLabs). The lentiviral vector for tetracycline-inducible expression of the Gαi2R179C and GαoAR243H mutants was constructed by first cloning Gαi2R179C and GαoAR243H from pcDNA3.1 to pENTR vector (Thermofisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coli DH5α competent cells (NEB #C2987H) and purified (Qiagen #12165) ...