Labshake search
Citations for New England Biolabs :
9551 - 9600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Colony PCRs for crRNA integrations into pCRISPR-Cas3 were performed using OneTaq® 2X Master Mix with Standard Buffer Enhancer (New England BioLabs Inc., U.S.A).
-
bioRxiv - Synthetic Biology 2023Quote: ... using 55 fmol of purified cassette after BbsI-HF (for photoautotrophy screening with p1 plasmids) or BsaI-HF (for antibiotic screening with pM plasmids) digestion (New England Biolabs) of the corresponding plasmid ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 100 ng of DNA and the PstI and HhaI enzymes (NEB). Paired-end reads with 150 cycles were obtained by sequencing the libraries on an Illumina Hiseq 4000 platform (Génome Québec Innovation Centre ...
-
bioRxiv - Microbiology 2023Quote: ... dual unique indexed libraries for sequencing on all Illumina platforms were made using the NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Manufacturer protocol was modified by diluting adapter 1:30 and using 3 μl of this dilution ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA was converted to double-stranded DNA by NEBNext Second Strand Synthesis (NEB). In addition ...
-
bioRxiv - Cell Biology 2023Quote: ... Phusion High-Fidelity DNA poly-merase (M0530L, NEB), PIK-III (17002 ...
-
bioRxiv - Genetics 2023Quote: ... All libraries were PCR amplified (NEB M0544S) for 5 cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Oligonucleotides encoding sgRNAs were custom synthesized (Integrated DNA Technologies; IDT, Coralville, IA) and phosphorylated by T4 polynucleotide kinase (New England Biolabs; NEB, Ipswich, MA) for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA fragments were amplified by PCR (Q5 2x Master Mix, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2023Quote: ... In brief, DNA fragments were amplified by PCR (Q5 2x Master Mix, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplification of repetitive units was generated by BioBrick restriction enzyme assembly using NheI and SpeI enzyme sets (New England BioLabs, USA). Subsequently ...
-
bioRxiv - Biophysics 2023Quote: ... 20 μL of the supernatant was restriction digested by 0.1 μL StuI (NEB R0187) in 56.5 μL 1× SmartCutter buffer (NEB B7204S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using the Quick-LoadR©Taq2×Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 units of proteinase K (P8107S, New England Biolabs) were added to each digestion and undigested control ...
-
bioRxiv - Molecular Biology 2023Quote: ... Precipitated DNA was washed with 70% ethanol and resuspended in 1X NEBuffer #2 (B7002S, New England Biolabs) with 2 μl RNase A (20 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA templates were then degraded by incubating reactions with 5 units of RNase H (M0297, New England Biolabs) and 1 μl RNase cocktail enzyme mix (AM2296 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2023Quote: ... reactions were digested with 10 units of T5 exonuclease (NEB) for 30 min at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... We performed a BsaI Golden Gate assembly (NEB, Golden Gate Assembly Mix) in T4 DNA Ligase Buffer in 20 µL volumes using equimolar pDT2 and the Cy5/biotin duplex at a final concentration of 6 nM each ...
-
bioRxiv - Biophysics 2023Quote: From the H6-RapA expression plasmid and pSNAP-tag(T7) plasmid (NEB #101137), we constructed a plasmid pKI1 (Addgene #199118 ...
-
bioRxiv - Molecular Biology 2023Quote: ... By Gibson cloning (New England Biolabs), ADH1pr-OsTIR1 was subsequently added into the pUC19 backbone along with ScLEU2 cassette and flanking regions of CgTRP1 for targeted insertion ...
-
bioRxiv - Microbiology 2023Quote: ... UL136mycΔK→R pGEM-T Easy construct was created by site-directed Phusion mutagenesis according to the manufacturer’s instruction (New England Biolabs). Inverse PCR was used to mutagenize lysines 4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of total RNA was used for mRNA isolation using NEBNext poly(A) mRNA Magnetic Isolation Module (New England Biolabs) and the purified mRNA was used to construct libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR fragments were cloned into the miniT vector (NEB), and assembled together in a Golden Gate reaction together with the terminator tHSP18.2 (Addgene GB0035 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and rabbit anti-NANOG (New England Biolabs). Briefly ...
-
bioRxiv - Synthetic Biology 2023Quote: Cell-free protein synthesis and 14C-Leucine quantification were performed as described previously using a modified PANOx-SP (PEP) formulation in an extract prepared from SHuffle T7 Express (NEB) cells (Warfel et al ...
-
bioRxiv - Systems Biology 2023Quote: ... We digested this vector backbone with EcoRV (NEB #R3195S) and gel purified the resulting linearized vector ...
-
bioRxiv - Systems Biology 2023Quote: ... and polynucleotide kinase (NEB #M0201S) and incubating in a thermocycler (Veriti #4375305 ...
-
bioRxiv - Zoology 2023Quote: ... or Q5 DNA Polymerase (New England Biolabs) for creating templates for in situ hybridization probes ...
-
bioRxiv - Neuroscience 2023Quote: ... Gibson assembly cloning (NEB BioLabs, lpswich, MA) was used to make plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... following the manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1% v/v proteinase K (New England Biolabs, P8107S) in 2×SSC for 36-48 hours at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... was digested with a NotI restriction enzyme (NEB) and used as a plasmid backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid pAR128 was generated by digesting pPL5920 with MluI-HF and NsiI-HF (New England Biolabs), PCR amplifying the UME6 locus (chrIV ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain NEB 10-beta (NEB Cat# C3019) was used for construction of plasmids by ligation-less Gibson assembly (Fu et al ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant SYNJ2BP (0.5 µg) was dephosphorylated using 1 µl of calf intestinal alkaline phosphatase (CIP) (NEB) in 1x CutSmart Buffer in a total volume of 10 µl ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA sequencing library preparation used NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s recommendations (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA was extracted and treated with DNase (DNase I, RNase-free, New England Biolabs, Ipswich, MA) according to the TRIzol reagent user guide (Pub ...
-
bioRxiv - Neuroscience 2023Quote: SadCas9-2xKRAB-p2a segment was amplified by PCR from backbone using high-fidelity polymerase (Phusion, NEB, Cat. No. M0530S); and tdTomato was PCR amplified from a proprietary expression vector using high-fidelity polymerase ...
-
bioRxiv - Microbiology 2023Quote: ... and ∼1.5kb flanking regions of the targeted gene were amplified using Phusion polymerase (New England BioLabs) with primers containing 20bp of homology to the pMQ30 SmaI cut-site at their 5’ end ...
-
bioRxiv - Microbiology 2023Quote: ... and the targeted small regulatory RNAs were amplified using Phusion polymerase (New England BioLabs) with primers containing 20bp of homology to the pMQ123 BamHI cut-site at their 5’ end ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl T4 RNA ligase 1 (10 U/μl, NEB) and 1 μl 3’ cDNA adapter (5’-amino-NNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-phosphate-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and a standard Phusion polymerase protocol (NEB). Amplified libraries were cleaned up after gel electrophoresis (selected size between 200 bp to 500 bp ...
-
bioRxiv - Microbiology 2023Quote: cDNA was synthesized from DNA-free RNA using random nonamers (New England BioLabs, Ipswich, MA) and SuperScript III RT (Invitrogen/ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl 40 U/μl−1 RNase Inhibitor (NEB), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μl 50% PEG 8000 (NEB), 1 μl 40 U/μl−1 RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were amplified using a 12 cycle PCR with NEBNext® Multiplex Oligos for Illumina protocol (NEB) and a standard Phusion polymerase protocol (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... alkaline phosphatase-treated pBOMBL12CRia(e.v.)::L2 for use in a HiFi reaction according to the manufacturer’s instructions (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... alkaline phosphatase-treated pBOMBL12CRia(e.v.)::L2 for use in a HiFi reaction according to the manufacturer’s instructions (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments were cloned into level 1 recipient plasmids (Supplemental table S3) from the MoClo ToolKit by a restriction/ligation reaction with BsaI and T4 DNA ligase (New England Biolabs) as previously described (Weber et al. ...