Labshake search
Citations for New England Biolabs :
8351 - 8400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Synthesized sgRNA was mixed with Cas9 protein (NEB# M0646T) just before microinjection into zebrafish embryo.
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a gBlock (IDT) was used to introduce the MluI cut site via Gibson assembly (Catalog no. E2611L, NEB). The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099 ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Developmental Biology 2023Quote: ... introducing restriction sites for XhoI (Catalog no. R0146s, NEB) and SmaI (Catalog no ...
-
bioRxiv - Developmental Biology 2023Quote: ... About 1ng DNA was used for library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Sequencing (2× 150bp ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBuilder kit (New England Biolabs [NEB], USA, product #E2621). Specifically ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted using the Monarch® Genomic DNA Purification Kit (New England Biolabs, Massachusetts; #T3010) with the Monarch® gDNA Tissue Lysis Buffer (#T3011 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBuilder kit (New England Biolabs [NEB], USA, product #E2621). Specifically ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA Magnetic Isolation Module and barcoded libraries were made using the NEBNext® Ultra II™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich, MA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were cleared by centrifugation (15 min, 12000 x g) and 100 units of λ-phosphatase (#P0753, New England Biolabs) were added to the supernatants ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... High molecular weight (HMW) DNA was released from the agarose blocks using β-agarase (NEB).
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a high-fidelity Q5 polymerase (NEB, USA product #M0491). For each polymerase chain reaction (PCR) ...
-
bioRxiv - Cell Biology 2023Quote: ... and FLAG-βTrCP2 (WD40Mut) were generated using the Q5 site-directed mutagenesis kit (NEB; Cat. #E0552S). The βTrCP1 WD40Mut changes amino acid 510 from R>A based on isoform 1 in uniprot (R474A when referring to isoform 2 in uniprot) ...
-
bioRxiv - Cell Biology 2023Quote: ... libraries were prepared for Illumina (New England Biolabs, Ipswich, USA) and the library preparations were sequenced on an Illumina Novaseq platform (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat. # 0146, New England Biolabs) to linearize plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... the FIP200-MBP-ATG13-ATG101 eluate and ULK1 eluate were mixed to allow reconstitution of the complex and loaded onto amylose resin (New England Biolabs). After 4 hours of incubation with the beads and extensive washing in washing buffer (20 mM HEPES pH 8 ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was collected and incubated with pre-equilibrated Amylose beads (Biolabs) for 2 h at 4°C with gentle shaking to bind MBP-TEV-NAP1 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA recovered from sucrose density gradient fractions was treated with 600 units/ml heparinase (NEB P0735S ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
HOIL-1L deficiency induces cell cycle alteration which causes immaturity of myocyte and fibrogenesisbioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were prepared using a NEBNext Ultra II RNA Library Kit for Illumina (New England Biolabs) with the NEBNext Poly (A ...
-
bioRxiv - Cell Biology 2023Quote: ... SgRNAs were synthesized using a sgRNA synthesis kit (New England Biolabs) as described by the manufacturer and purified using RNA-clean 25 columns (ZYMO Research ...
-
HOIL-1L deficiency induces cell cycle alteration which causes immaturity of myocyte and fibrogenesisbioRxiv - Cell Biology 2023Quote: ... with the NEBNext Poly (A) mRNA Magnetic Isolation Module (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... SNAP-tag (New England BioLabs, N9181S), HaloTag (Promega ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 20 µl reactions and products were run on a 1% agarose gel alongside an appropriately sized ladder (either New England Biolabs 100 bp or 1kb DNA ladder) and stained post-electrophoresis with GelRed® (Biotium) ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were generated by PCR amplification of open reading frames (ORFs) in cDNA and ligation into a linearized pHAGEb vector using a Gibson assembly kit (New England Biolabs). dH5a or Stable competent E ...
-
bioRxiv - Cell Biology 2023Quote: ... Four fragments were built up using an NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs) to create pKO-hUGGT1-Puro ...
-
bioRxiv - Cell Biology 2023Quote: ... Q5 Site-Directed Mutagenesis (NEB) with primers PNPLA3-FLAG_fwd and PNPLA3-FLAG_rev (Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: We generated new expression constructs by SLIC (29, 30) and seamless cloning (NEBuilder® HiFi DNA Assembly, New England Biolabs, Cat. No. E2621S). For PCR amplification from plasmids or Bd genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... coli cells (New England Biolabs) were then transformed with assembled plasmids and grown on LB agar plates with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2023Quote: All plasmids were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). pXT7 and pDEST vectors were a kind gift from the group of Laure Bally-Cuif ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Cell Biology 2023Quote: ... Restriction enzyme was inactivated using 1.6% of SDS for 25 minutes at 65°C and chromatin was ligated by adding 4000 U of T4 ligase (New England Biolabs, M0202M) in 1× T4 DNA ligase buffer (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... Chromatin was digested with 1000 U of HindIII (New England Biolabs, R0104M) overnight at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1× T4 DNA ligase buffer (New England Biolabs, B0202S) containing 1% TritonX-100 and for 4 hours at 16°C followed by additional incubation for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... SNAP-Cell TMR-star (New England BioLabs, S9105S) and HaloTag ligand CF650 (GoryoChemical A308-02 ...
-
bioRxiv - Cell Biology 2023Quote: ... which were then degraded by the 5’-3’ ssDNA exonuclease RecJ (NEB, M0264S). After rRNA reduction using the riboPOOL rRNA depletion kit (siTOOLs Biotech ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli were performed with the Monarch® Plasmid Miniprep Kit (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and a 1.8 kb backbone using Gibson Assembly (NEB). A pair of guide RNAs (gRNAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pif expression was assessed with the Luna® Universal Two-Step RT-qPCR Master Mix (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... followed by column purification using Monarch Total RNA Miniprep Kit (New England Biolabs). The ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: The 3’ ends of the ribosome footprint RNA fragments were treated with T4 polynucleotide kinase (New England Biolabs, M0201) to allow ligation of a pre-adenylated DNA linker with T4 Rnl2(tr ...
-
bioRxiv - Cell Biology 2023Quote: ... to allow ligation of a pre-adenylated DNA linker with T4 Rnl2(tr) K227Q (New England Biolabs, M0351S). The DNA linker used incorporates sample barcodes to enable library multiplexing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs) was used for the synthesis of cDNA using the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Some libraries have been instead prepared with the NEBNext Ultra II DNA PCR-free Library Prep Kit (New England Biolabs, Ipswich, MA, USA). Samples were either double indexed with a set of 60 dual-index primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were prepared using the NEB Ultra II Directional RNA Library Prep Kit (New England BioLabs, Ipswich, United States), and all samples were run on one lane of the NovaSeq6000 S4 v1.5 (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Final eluates were used as input for strand-specific RNA-seq library construction using the NEBNext RNA Library Prep Kit (New England Biolabs). Libraries were fractionated on 4% agarose E-gels (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Gibson Assembly (New England Biolabs E5510S) or In-Fusion HD Cloning Plus (Takara 638909) ...
-
bioRxiv - Cell Biology 2023Quote: ... and subsequently digested with SspI and BamHI (New England Biolabs) before being ligated into pET-His6-Sumo digested with the same enzymes ...