Labshake search
Citations for New England Biolabs :
8301 - 8350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... samples were treated with DnaseI (New England Biolabs). The polyA-enrichment was performed with NEXTflex™ Poly(A ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Genomics 2023Quote: ... 0.35 μL Q5 (NEB M0491S)) and incubation at 65°C for 3 min ...
-
bioRxiv - Genomics 2023Quote: ... RNAse inhibitor (NEB cat# MO314L) was added to the homogenization buffer (0.32 M sucrose ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 15μL gap-fill mix (7 μL Q5 reaction buffer (NEB), 7 μL Q5 high GC enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... Excessive primers were digested with the addition of 0.5 μL Exonuclease I (NEB M0293S), and incubation at 37°C for 30 min and 72°C for 20 min ...
-
bioRxiv - Genomics 2023Quote: ... The remaining thirteen samples had paired-end sequencing libraries constructed according to the manufacturer’s specifications for the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB). Three samples (RMF031 ...
-
bioRxiv - Genomics 2023Quote: ... 0.6 μL oxidation supplement (NEB), 0.6 μL oxidation enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 2.4 μL TET2 (NEB E7125S), 3 μL 1:1,249 diluted Fe2+ solution (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were then treated with EcoGII by adding 200 U of EcoGII (NEB) and SAM at 0.6mM and incubated at 37°C for 1hr with gentle shaking at 900rpm ...
-
bioRxiv - Genomics 2023Quote: ... TET2 reaction was terminated by addition of 0.6 μL stop solution (NEB) and incubation at 37°C for 30 min ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 15 μL 2x Q5U Master Mix (NEB M0597S), 0.4 μL 100 μM Nextera P5 index primer and 0.4 μL 100 μM Nextera P7 index primer ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA fragments were then either methylated using non-specific adenine EcoGII methyltransferase (New England Biolabs, high concentration stock 2.5e4 U/mL) or left unmethylated ...
-
bioRxiv - Genomics 2023Quote: Nuclei were resuspended in 200 uL of Methylation Reaction Buffer (Buffer M containing 1mM S-adenosylmethionine (SAM)) (New England BioLabs B9003S). 10uL high-concentration EcoGII was added per 1e6 nuclei and the nuclei suspension was incubated at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Genomics 2023Quote: ... was end repaired and adapters were ligated to it following the procedure of the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S), purified using AMPure XP beads and eluted in 50 μL of H2O ...
-
bioRxiv - Genomics 2023Quote: Sample DNA concentrations were quantified using Qubit and libraries prepared using NEBNext Ultra II DNA library preparation kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Immunology 2023Quote: ... The sgRNA sequence was PCR-amplified using high-fidelity Q5 DNA polymerase (NEB, Cat# M0491L) with barcoded primers from genomic DNA for library construction ...
-
bioRxiv - Immunology 2023Quote: ... for mouse was PCR-amplified and ligated into this vector via Gibson assembly (NEB, Cat# E2621S). The ligated product was precipitated ...
-
bioRxiv - Immunology 2023Quote: ... and 10 μL of PEG 8000 50% (NEB, cat. no: M0204S). The ligation mix was then incubated for at least 18 hours up to a maximum of 23 hours at 16 °C and then heat inactivated at 65 °C for 10 minutes ...
-
bioRxiv - Immunology 2023Quote: ... by IPTG induction as per the New England Biolabs (NEB) protocol for BL21 (C2530) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mCherry-Trim21 fragment was PCR amplified (Phusion high fidelity DNA polymerase, MO530S) to introduce ClaI restriction sites (fwd TAATTATCGATTATAATGGTGAGCAAGGGCGAGGA, rev TATTAATCGATCCGCTCACATCTTTAGTGGACAGA) The PCR product was purified (NEB Monarch PCR and DNA purification kit ...
-
bioRxiv - Genetics 2023Quote: ... RNA libraries for RNA-seq were prepared using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB, #E7760L) following manufacturer’s protocol for use with NEBNext Poly(A ...
-
bioRxiv - Genetics 2023Quote: ... following manufacturer’s protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, #E7490). Libraries were checked for quality and average fragment size using ScreenTape analysis ...
-
bioRxiv - Genetics 2023Quote: ... was then linearized by Esp3i digestion and the HDAC4 PCR fragment was annealed downstream into the open reading frame with gibson assembly using NEB HiFi mastermix (NEB 2621L). After delivering the construct by lentivirus ...
-
bioRxiv - Genetics 2023Quote: ... the primary probes were amplified using Phusion® High-Fidelity PCR Master Mix with HF Buffer (M0531S, NEB) by monitoring the amplification on a qPCR machine (CFX Connect ...
-
bioRxiv - Genetics 2023Quote: ... Sulfolobus DNA polymerase IV (Cat. No. M0327) and DNA polymerase ζ (Cat. No. 51) were purchased from NEB and Enzymax ...
-
bioRxiv - Genetics 2023Quote: ... Sequencing adapters ligation was carried out using NEB Quick Ligase (NEB cE7180S) and Oxford Nanpore’s ligation buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and quantitative real-time PCR was performed using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 96-well plate and qPCR was performed in a LightCycler 96 System (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... digested with ClaI (NEB, R0197S) for 2 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmid ISceI/MCS-d1GFP-SV40/ISceI was digested with XhoI (NEB) and SmaI (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: The donor plasmid pBS-Eno-Mutpi was generated by assembly of PCR fragments into pBS-SK+ digested by EcoRI and KpnI using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB) and primers designed for amplifying ≈1 kb long homology arms from w1118 genomic sequence ...
-
bioRxiv - Developmental Biology 2023Quote: ... nosP-5’Eno-GFP-3’Eno and nosP-5’Eno-GFP-3’SV40 plasmids were generated by assembly of PCR fragments into the pNOSPE_MCP_eGFP vector 63 digested by NotI and BamHI using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB). pNOSPE_MCP_eGFP contains the nanos promoter ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Sox2(600bp)::GFP plasmid was generated by digesting the primer overhangs of the PCR product with XhoI and EcoRV (NEB) and its consequent ligation into linearised plasmid ISceI/MCS-d1GFP-SV40/ISceI ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG8000 (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... coli DNA polymerase I (NEB, cat# M0209S), 50μM dATP ...
-
bioRxiv - Genetics 2023Quote: ... 1x106 HEK293T cells were collected and their gDNA was extracted using the NEB Monarch kit (T3010S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Genetics 2023Quote: ... using Q5 hot start polymerase (NEB M0494S). A lentiviral backbone containing pEF1alpha-driven expression of 3xFLAG-tagged rTetR(SE-G72P ...
-
bioRxiv - Genetics 2023Quote: ... NEB Q5U polymerase (M0515, NEB) was used according to manufacturer’s specifications to amplify reporter DNA from the pool of gDNA while maintaining the identity of converted uracils ...
-
bioRxiv - Genetics 2023Quote: ... Single-stranded RNA was synthesized from the PCR product using Hiscribe T7 Quick High Yield RNA Synthesis Kit (E2050S, NEB). The ssRNA was then converted into ssDNA using Maxima H Minus Reverse Transcriptase (EP0753 ...
-
bioRxiv - Genetics 2023Quote: ... 8.5 μl of phosphorylated product was combined with 1 μl of 10x T4 ligase buffer and 0.5 μl of T4 DNA ligase (NEB), incubated at 16℃ overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... I-SceI enzyme (NEB R0694) 5 units ...
-
bioRxiv - Developmental Biology 2023Quote: ... and indexing was performed using single index oligos (NEB, 7710/7730). The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR products were treated with DpnI (NEB) to remove the template plasmid DNA and then self-ligated using Ligation High Ver2 (Takara) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Complete sgDNA templates were assembled and amplified using the T7 promoter (Phusion High Fidelity, NEB E0553). sgRNA was then transcribed (MEGAshortscript T7 ...