Labshake search
Citations for New England Biolabs :
7401 - 7450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 40 U Murine RNase Inhibitor (NEB), 10% DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5b (1× T4 RNA ligase buffer (NEB), 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C overnight) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was then supplemented with 40 mM tris·HCl pH 8.3 and 0.5 U/µl RppH (NEB) before incubation (37°C 80 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was then treated with RNA pyrophosphatase (NEB) and then ligated with a ‘Transcription Start Site’ (TSS ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Physiology 2023Quote: ... PCR amplified fragments were assembled with BamHI and SbfI linearized pUA139 using the NEBuilder HiFi DNA Assembly kit (New England Biolabs Inc., MA, USA) to generate pTE24G ...
-
bioRxiv - Physiology 2023Quote: ... which were then mixed together with Gibson Assembly Master Mix - Assembly (NEB #E2611) and incubated at 50°C for 15 minutes ...
-
bioRxiv - Physiology 2023Quote: ... Both PCR products were digested with PstI (NEB) and ligated using a T4 DNA ligase ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli BL21(DE3) (New England Biolabs). TEV protease (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR amplifications were performed using Q5 High-Fidelity DNA polymerase Master Mix 2x from New England Biolabs (NEB). Due to the high GC content of C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Physiology 2023Quote: ... individuals from each species using the Monarch total RNA Miniprep Kit (T2010S, New England Biolabs, Ipswich, MA) following manufacturer instructions ...
-
bioRxiv - Physiology 2023Quote: ... and 96 Unique Dual Indices (E7765L, New England Biolabs). The skin RIN scores were much lower ...
-
bioRxiv - Physiology 2023Quote: ... with the PolyA purification bundle (E7490L, New England Biolabs) and 96 Unique Dual Indices (E7765L ...
-
bioRxiv - Physiology 2023Quote: ... primers for separate glnA and gfp fragments were generated using the NEBuilder Assembly Tool (neb.com, New England Biolabs Inc., MA, USA). The fragments carry overlapping segments to one another and with the pUA139 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Plant Biology 2023Quote: ... Histone (NEB).
-
bioRxiv - Plant Biology 2023Quote: PCR amplification was done using Q5 DNA polymerase and manufacturer guidelines (New England Biolabs Ltd.) and all plasmid constructs were generated by standard molecular cloning techniques and confirmed by Sanger DNA sequencing (TGCA Sequencing Centre ...
-
bioRxiv - Plant Biology 2023Quote: ... The library was amplified 17 cycles by Q5 high fidelity polymerase (NEB, M0491L). Antibodies used for histone modifications are the same as previous reported (Zhao et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... and endoproteinase Lys-C (NEB-P8109S) at a ratio of (1:25 ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCRs were conducted with the proof-reading enzyme Phusion (New England Biolabs) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was completed using the Luna Universal qPCR Master Mix (New England Biolabs). The Elongation Factor 2 homologue (GdEF-2 ...
-
bioRxiv - Plant Biology 2023Quote: ... the NPTII gene cassette (including promoter and terminator) was cloned into pAGM1311 and modified using HiFi DNA Assembly Cloning Kit (NEB, Ipswitch, MA) to replace the complete coding sequence of NPTII with the coding sequence of the hygromycin resistance gene from pMDC735 ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: ... The amplified PCR products were then ligated with T4 DNA Ligase (NEB) and the CRY2 sgRNA genes were subcloned into the modified DSB/DSB PcUbi4-2 plasmids (i.e. ...
-
bioRxiv - Plant Biology 2023Quote: ... blunted with T4 DNA Polymerase (New England Biolabs, Ipswitch, MA), and re-ligated using T4 DNA Ligase (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... Digestions were performed overnight at 37°C with 400U DpnII (NEB). DNA was ligated by incubation in a shaker at 16°C ...
-
bioRxiv - Plant Biology 2023Quote: ... and re-ligated using T4 DNA Ligase (NEB). All RT-based plasmids (lacking Cas9 ...
-
bioRxiv - Systems Biology 2023Quote: ... the vector was digested with MluI-HF and PacI restriction enzymes (NEB), with the addition of rSAP (NEB) ...
-
bioRxiv - Systems Biology 2023Quote: ... The cDNA was amplified with Q5 polymerase (NEB) using primers CAAGCAGAAGACGGCATACGAGAT - i7 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCCTGCTAGCTAGATGACTAAACGC and CAAGCAGAAGACGGCATACGAGAT - i5 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTACCCGTCATTGGCTGTCCA ...
-
bioRxiv - Systems Biology 2023Quote: ... Immunoprecipitated RNA fragments were then dephosphorylated (T4 PNK, NEB), polyadenylated ...
-
bioRxiv - Systems Biology 2023Quote: ... The digested DNA library and the digested vector were ligated with T4 DNA ligase (NEB). The ligation reaction was precipitated with isopropanol and transformed into MegaX DH10B T1R Electrocompetent Cells (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... Strep–PIF4 recombined proteins were expressed in the Escherichia coli BL21 (DE3) strain and then purified using amylose resin (NEB, E8021S). DNA probes of NHX1 and SAL1 were synthesized and labeled using the Biotin 3′ End DNA Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... or pMAL-C2 vector (NEB) in frame with an MBP tag ...
-
bioRxiv - Plant Biology 2023Quote: ... by comparison of the extracted DNA stained with ethidium bromide with a molecular weight marker (2-Log DNA ladder, New England Biolabs® Inc.). The DNA samples were stored at −70 °C (18 months for RS and a week for URBC) ...
-
bioRxiv - Zoology 2023Quote: ... Library concentration and quality were assessed with the Qubit Fluorometer and Bioanalyzer and molarity was estimated via qPCR with the NEBNext Library Quant Kit (New England Biolabs). Libraries were single indexed with NEBNext Multiplex Oligos (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: ... Preparation of RNA library (non-directional 250∼300 bp insert cDNA library (NEB)) and transcriptome sequencing (Illumina Novaseq 6000 paired-end 150 ...
-
bioRxiv - Plant Biology 2023Quote: ... Real time reactions were performed using Luna® Universal qPCR Master Mix from NEB. Oligonucleotides were used to detect GFP-VAMP (56 and 57 ...
-
bioRxiv - Zoology 2023Quote: ... sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Frankfurt, Germany) according to the manufacturer’s instructions without prior fragmentation ...
-
bioRxiv - Zoology 2023Quote: ... One μl of the resulting cDNA was next amplified by PCR for 30 cycles using either OneTaq DNA Polymerase (New England Biolabs) for RT-PCR experiments ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... we combined 50 ng of backbone with 25 ng of annealed oligo along with T4 ligase buffer (NEB #B0202S), T4 ligase (#M0202S) ...
-
bioRxiv - Systems Biology 2023Quote: ... was decided by calculating the cycle threshold value from a qPCR reaction using the NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB #M0543L) for the specified cDNA concentration ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and neomycin resistance were PCR-amplified from extant constructs present in our laboratory using NEB Q5 Hot-Start 2X Mastermix according to the manufacturer’s protocol (New England Biolabs, Ipswitch, MA, USA; M0494L). HDR-donor assemblies were completed using NEBuilder HiFi 2X Mastermix in accordance with the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: Synthetic DNA sequences encoding for the proteins were ordered from IDT as eblock or gblocks and cloned into a pet28b(+) vector using Gibson Assembly (NEBuilder, New England Biolabs). All constructs included a N-terminal His Tag and Heterodimers and 600mers additionally had a c-terminal strep tag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Zoology 2023Quote: ... We performed 5 PCR enrichment with 15 cycles (30 ng DNA input, NEB Phusion High-Fidelity PCR Master Mix) for each library to increase fragment diversity ...