Labshake search
Citations for New England Biolabs :
6051 - 6100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Coli NEB® 5-alpha aliquot (NEB®, #C2987H). Plasmids were sanger sequenced by GeneWiz (Azenta Life Sciences ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Immunology 2024Quote: ... and sticky end ligation (New Englands Biolabs). The sgRNA sequence used to generate LRP1 knockout cells is (5’-3’) ...
-
bioRxiv - Immunology 2024Quote: ... with BsmBI digestion (New Englands Biolabs) and sticky end ligation (New Englands Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 300 pmol of Cas9 protein (NEB, Cat. No. M0386M) and 600 pmol of sgRNA were incubated in Cas9 Buffer (150 mM KCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl Proteinase K (NEB, NEB, P8107S), 5 µl H2O (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dephosphorylation reaction was supplemented with 0.5 μl T4 PNK (NEB, Cat. No. M0201S), and the reaction was incubated for 25 minutes ...
-
bioRxiv - Microbiology 2024Quote: Total RNA samples were treated with a NEBNext rRNA depletion kit (NEB) to remove rRNA ...
-
bioRxiv - Microbiology 2024Quote: ... followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs). 10 µg Capped mRNA transcripts were electroporated into BHK-21 cells in a 0.2 cm cuvette (25 μF ...
-
bioRxiv - Microbiology 2024Quote: ... The mCherry gene was cloned into the pLV plasmid using using NEBuilder® HiFi DNA Assembly (New England Biolabs), to generate the final pLV-mCherry product ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was produced using a ProtoScript® II Reverse Transcriptase (New England Biolabs) reaction and a Spike-specific reverse primer (5’ CTGAAGGAGTAGCATCCTTG 3’) ...
-
bioRxiv - Microbiology 2024Quote: ... Empty pCAGGS plasmid vector was digested using restriction enzymes KpnI-HF and SphI-HF (New England Biolabs) and purified using QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... remnant parent templates were digested using DpnI (New England Biolabs), and DNA products were gel purified using Zymo Gel DNA Recovery Kit (Zymogen) ...
-
bioRxiv - Microbiology 2024Quote: ... coli (New England Biolabs), which were plated and incubated at 37°C overnight on LB Agar Carbenicillin (100 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... These PCR products were inserted into EcoRI-XhoI-digested linearized pCAGGS using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Ipswich, MA, USA). Previously constructed plasmids expressing G of VSBV-1 ...
-
bioRxiv - Microbiology 2024Quote: ... backbone (containing Blasticidin resistance gene for the selection of transduced cells) and mCherry gene were PCR amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs), remnant parent templates were digested using DpnI (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... Spike DNA fragments were introduced into the digested pCAGGS vector using NEBuilder® HiFi DNA Assembly (New England Biolabs). The product of this assembly reaction was transformed into 5-alpha Competent E ...
-
bioRxiv - Microbiology 2024Quote: ... Unused primers were then degraded with Exonuclease I (NEB). The cDNA from different samples was then combined into pools ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L). Target sequences were amplified using a modified touchdown PCR protocol (Korbie and Mattick ...
-
bioRxiv - Immunology 2024Quote: ... were made using restriction enzymes and T4 DNA ligase from New England Biolabs (NEB, Whitby, ON). The immunoglobulin heavy chain enhancer (EiH ...
-
bioRxiv - Immunology 2024Quote: ... Primers were designed using the NEBaseChanger tool (NEB) and are shown in Supplemental Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... and amplified by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, USA; #M0494) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and ER2796 (NEB) were grown at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and Phusion DNA polymerase (New England BioLabs). dsDNA amplification was confirmed by 1.5% agarose gel electrophoresis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Sequencing libraries were generated using NEB Next® UltraTM DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli poly(A) polymerase (NEB) at 37 °C for 30 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reaction mixtures were treated with DNase I and incubated at 37 °C for 30 minutes before immediate purification (Monarch® RNA Cleanup Kit, NEB). A sample of each mRNA was reserved for quality analysis and transcripts were tailed with E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... signal was synthesized by Integrated DNA Technologies and inserted at the 3’UTR of the L1 mRNA using Hifi Assembly mix (NEB). gBlocks gene fragments containing different PBS site sequences were synthesized by Integrated DNA Technologies ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and subsequently purified (Monarch® RNA Cleanup Kit, NEB). All tailed and untailed mRNA samples were normalized to a concentration of 50ng/µl and quality was assessed via TapeStation RNA ScreenTape Analysis (Agilent ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All PCR reactions were carried out in 30 μL reactions with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genomic DNA samples were PCR amplified with Q5 High-Fidelity 2X PCR Master Mix (NEB) based on the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... 1ul of HindIII-HF restriction enzyme (NEB, UK). The remaining 7.8ul was adjusted with NFW and extracted DNA for standard ddPCR ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids containing the gene of interest fused to an N-terminal His6 tag in the pet28A vector were obtained from Genscript and transformed into BL21-DE3 competent cells (New England Biolabs). After growth overnight at 37°C on an agar plate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were analyzed by 1% agarose gel electrophoresis and purified according to the sizes using the DNA Gel Extraction Kit (NEB).
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCR reactions were performed using Q5 High-Fidelity 2X PCR Master Mix (NEB) with optimized Tm and the PCR products were detected by 1% agarose gel.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were harvested by scraping and total RNA was isolated using the Monarch Total RNA Miniprep kit (T2010S, New England Biolabs Inc., Ipswich, MA, USA) according to the supplierś instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... library preparation (NEBNext Ultra II RNA Library Prep kit, New England Biolabs Inc.) and Illumina NovaSeq 2 × 150 bp paired-end sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... CAGE libraries were treated with Exonuclease I (NEB) to degrade any single-stranded DNA before sequencing on NextSeq 500 using SR50 to obtain around 40 M reads for each library ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1μg RNA was used for sequencing libraries using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cancer Biology 2024Quote: ... digested with BstXI and XhoI (NEB) and inserted into pSLQ1651-sgTelomere (F+E ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PCR fragment and pSLQ1651-sgTelomere (F+E) were digested with NheI and EcoRI (NEB), ligated and transformed into Stbl3 competent bacteria (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used for tagmentation and amplified with Nextera Ad1_noMX and Ad2.X primers (Supplementary Table 5) using 2x Phusion high-fidelity PCR mix (NEB). AMPure beads (Beckman coulter ...
-
bioRxiv - Cancer Biology 2024Quote: ... and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Inverse PCR was performed using 4C_ALKATI_EcoRI or 4C_ULK4int31_NlaIII (reading) and 4C_ALKATI_DpnII or 4C_ULK4int31_DpnII (non-reading) primers with 2x Phusion high-fidelity PCR mix (NEB). Each 4C sample was amplified in 4 PCR reactions ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNA was digested with Thermolabile USER (Uracil-Specific Excision Reagent) II (NEB, M5508) overnight before alkaline hydrolysis in 1M NaOH at 65°C for 15 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S) and purified using Monarch® RNA Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA isolated from cells was reverse transcribed using LunaScript® RT SuperMix Kit (New England Biolabs) to generate cDNA as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... by directly adding 5U of calf intestine phosphatase to the mix (New England Biolabs) in 100 mM Tris-HCl ...