Labshake search
Citations for New England Biolabs :
551 - 600 of 1210 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The purified plasmid DNA (5 µg) was incubated with T4 DNA ligase (NEB, M0202) (2.5 µL ...
-
bioRxiv - Systems Biology 2022Quote: ... we performed a standard PCR using all 10μl of eluted DNA with 25μl 2x NEB High-Fidelity master mix (NEB, MO544), 2.5μl of 25μM forward primer (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... expressed in BL21 cells with IPTG induction and affinity-purified on an amylose column using standard protocols (NEB #E8200S). Guinea pig reactive serum was produced by UC Davis Comparative Pathology Laboratory ...
-
bioRxiv - Genetics 2020Quote: Total RNA was extracted using the standard hot acid phenol method and treated with DNase 1 (New England Biolabs). qRT-PCR was performed using amfiRivert cDNA synthesis Platinum Master Mix from Gendepot ...
-
bioRxiv - Physiology 2021Quote: ... Qualifying samples were then prepped following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... pEGFP-C1 or pcDNA5/FRT/TO-N-TAP with gateway cloning using the SP6-CHIKV-replicon-SG-GLuc as a template. Mutants (except for replicon mutants, see above) were generated using standard mutagenesis procedures (e.g. Q5 mutagenesis kit (NEB)) and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Qualifying samples were then prepped following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Cell Biology 2020Quote: ... or OneTaq® Hot Start Quick-Load® 2X Master Mix with Standard Buffer (M0488L, New England BioLabs inc.) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... standard PCR reactions were performed on 1 ul of cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and each of the variant PCR primer pairs independently ...
-
bioRxiv - Genomics 2020Quote: ... Locus-specific PCR was performed using the standard protocol for Q5 Hot Start Master Mix (New England BioLabs M094S). PCR was also performed on unedited DNA extracted from PGP1 iPSCs as a control for background.
-
bioRxiv - Physiology 2021Quote: ... Qualifying samples were then prepped following the standard protocol for the NEBNext Ultra II Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired-End 42bp × 42bp reads ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The oligo was PCR amplified with OneTaq® 2X Master Mix with Standard Buffer (New England BioLabs Inc., M0482L), followed by agarose gel purification with GenCatch Advanced Gel Extraction Kit (Epoch Life Science ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 11.25 μ L OneTaq Hot Start 2X Master Mix with Standard Buffer (Catalog No. M0484, New England BioLabs Inc.), 1.25 μ L Chai Green Dye 20X (Catalog No ...
-
bioRxiv - Synthetic Biology 2023Quote: ... To generate standard curves for absolute qPCR we linearized pTransgene (p8-pAAV2.1 CMV eGFP3)37 with XhoI and NheI enzymes (NEB) and diluted in PCR-grade water from 2.5× 10^8 to 25 copies/μL in 10-fold serial dilutions ...
-
bioRxiv - Cell Biology 2023Quote: ... All expression plasmids were generated using standard cloning procedures and the NEBuilder HiFi DNA assembly system (New England Biolabs). All PCR amplified sequences were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were stranded using standard N.E.B indices according to manufacturer’s instructions (New England Biolabs, Cat. No. E7730L, E7335L, E7500L). Sequencing reads were aligned to the human reference genome (hg19 ...
-
bioRxiv - Microbiology 2023Quote: ... This was followed by PCR using One Taq Quick-Load 2x Master Mix with Standard Buffer from BioLabs (UK).
-
bioRxiv - Genomics 2024Quote: ... were carried out for a final volume of 12.5 µL containing 1x OneTaq HS Quick-Load Master Mix with Standard Buffer (NEB), 0.2 µM of each forward and reverse Intron-flanking primers (Supplementary Table 7) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then prepped according to the standard protocol for NEB next Ultra ii Stranded mRNA (New England Biolabs). All samples had an RNA Integrity Number (RIN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genes of interest were cloned into Bxb1 attB-containing plasmids using standard Gibson assembly cloning techniques (NEB cat #E2621L). To stably recombine the attB plasmids under control of the landing pad promoters ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Biophysics 2024Quote: ... The lysate was pre-cleared using protein G magnetic beads (New England Biolabs). The cleared supernatant was then incubated with 3 µg anti-myc antibody (SIGMA M4439 monoclonal anti c-myc or Abcam ab206486 rat mAb to myc tag (9E10) ...
-
bioRxiv - Cell Biology 2020Quote: ... All of the DNA fragments were commercially synthesized (BEIJING LIUHE, Co. Ltd Guangzhou, China) and cloned into the LentiHBB vector using the Gibson assembly (NEB, E2611L). Lentivirus vectors of laboratory were produced by co-transfection of HEK293T cells with the transfer plasmid LentiHBB ...
-
bioRxiv - Cell Biology 2023Quote: ... SEC61β-OPG was generated by PCR amplification using primers ATCACTCTCGGCATGGACGAGCTGTACAAGAGATCTATGCCTGGTCCGACC and GGTATGGCTGATTATGATCAGTTATCTAGATTACCCTGTCTTATTGCTAAATGGA AC and the obtained product was co-transformed with pEGFP-C1-2µ-URA3 cut with BamHI (NEB, R3136) into yeast strain BY4743 (EUROSCARF Y20000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The dsDNA substrate was prepared by annealing and ligating two custom oligonucleotide handles (IDT) at the COS sites of bacteriophage λ-DNA (NEB), such that one end of the DNA contained a biotin modification while the other a digoxigenin (dig) ...
-
bioRxiv - Microbiology 2024Quote: ... The “co-culture” RNA sample was treated with an NEBNext® Poly(A) mRNA Magnetic Isolation kit (New England Biolabs, UK), and 100 µl of the produced supernatant (bacterial fraction ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was further purified by treatment with DNase I (RNase-free, New England Biolabs) and heat inactivation of the enzyme as recommended by the manufacturer.
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold and the cleavage products were resolved by native 1.2% agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... the free primer was removed by Exonuclease I (80 U; M0293S, NEB, Ipswich, MA), and a 3’ DNA adaptor was ligated onto the cDNA product with T4 RNA Ligase 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 6µg of total RNA was treated with RNase-free DNase I (New England Biolabs) for 3 h at 37 °C to remove contaminating chromosomal DNA and precipitated with 0.1 volume of 3 M sodium acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA-free RNA was purified using Monarch RNA Clean-up Kit (New England Biolabs) and visualised on an agarose gel.
-
bioRxiv - Molecular Biology 2022Quote: ... 22.5 uL Rnase-free water and 50 µL Blunt/TA Ligase Mix (NEB, M0367S) and incubated in room temperature for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 22.5 µL Rnase-free water and 50 µL Blunt/TA Ligase Mix (NEB, M0367S) and incubated in room temperature for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Contaminating DNA was degraded by treatment with RNase-free DNase I (New England Biolabs) for 10 min at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: Total RNA was extracted from cell-free expression reactions with a kit (NEB #T2010), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Isolated DNA was treated with DNase-free Monarch® RNase A (New England Biolabs) to get rid of any RNA contamination ...
-
bioRxiv - Molecular Biology 2022Quote: ... treated with phenol-free RNA Binding Buffer (included in RNA Cleanup Kits from NEB) and Proteinase K ...
-
bioRxiv - Molecular Biology 2023Quote: ... free adapters were removed by adding 3 units of RecJf (New England Biolabs, M0264) and 1.7 units of 5ʹ deadenylase (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNA samples were treated with DNase I (NEB, RNase-free, Ipswich, MA, USA) and approximately 1 μg of RNA was reverse transcribed using SuperScriptTM II RT (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6.5 μl Nuclease-free H2O and 0.5 μl T4 Polynucleotide Kinase (PNK) (NEB, M0201). The oligos were annealed in a thermocycler with gradual T reduction from 95°C to 25°C at a rate of 5°C/min and subsequently diluted 1:20 into Nuclease free water (ThermoFisher Scientific AM9938) ...
-
bioRxiv - Genomics 2024Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was eluted in 50 µl of nuclease free H2O (New England BioLabs). Subsequent cDNA generation was set up using the LunaScript® RT SuperMix Kit and its corresponding manual ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and placed in single-cell suspension in 1 mL RPMI+10% FBS ...