Labshake search
Citations for New England Biolabs :
5751 - 5800 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 16 ng/uL single-stranded pooled oligos were amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB) with the following PCR protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Regions of interest were amplified by PCR using a One-Taq Hot Start DNA-polymerase (New England Biolabs) with standard buffer and 3% DMSO and the following primers targeting exon2 (L ...
-
bioRxiv - Genomics 2020Quote: ... the beads resuspended in 20μL EB buffer were used for PCR amplification using 25μl Phusion High-fidelity MasterMix (2X) (New England BioLabs), 4 μl nuclease-free water and 0.5 μl PCRgraftP5 primer (5uM ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... upstream and downstream regions of about 750 bp flanking the each gene were amplified by PCR (Q5 NEB) from the B ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were cloned into a pBR-PLac vector digested with AatII and EcoRI (New England Biolabs)(54 ...
-
bioRxiv - Molecular Biology 2022Quote: Linear double-stranded DNA templates were prepared by 500uL PCR reactions using 50uL 10X Thermo Pol buffer (NEB), 10uL dNTP (10mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... and barcoded libraries were generated using the NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) and Nextera index primers (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... All PCRs were performed with the Q5 Hot Start HF DNA Polymerase (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were PCR amplified from the entire isolated genomic DNA using NEBNext Ultra II Q5 Master Mix (NEB) and the primers v2.1-F1 and v2.1-R1 ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of PCR products were mixed with 5.5 uL ddH2O and 1.9 uL 6X gel loading dye (NEB) and loaded onto 1% w/v agarose gels cast with SYBR Safe DNA gel stain ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR fragment and the vector were gel extracted and combined in a Gibson Assembly Reaction (NEB, E2611S) and transformed into DH5α ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Microbiology 2022Quote: ... Synthesized cDNA was used as template in PCR with the Q5 high-fidelity DNA polymerase (New England BioLabs) using intergenic region primers (Table S3 & S4) ...
-
The Arabidopsis MCTP member QUIRKY regulates the formation of the STRUBBELIG receptor kinase complexbioRxiv - Plant Biology 2022Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed on genes within pDNR207 constructs with Q5 High-Fidelity polymerase (New England Biolabs, Ipswich MA), and all constructs were sequence verified by GeneWiz prior to cloning into binary vectors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR amplifications were performed using Q5 High-Fidelity DNA polymerase Master Mix 2x from New England Biolabs (NEB). Due to the high GC content of C ...
-
bioRxiv - Molecular Biology 2022Quote: The PCR reactions were prepared as follows: Mix 1 μl of Phusion DNA Polymerase (New England Biolabs, M0530), 10 μl of 5x Phusion HF Buffer ...
-
bioRxiv - Cell Biology 2022Quote: The ARPC4 genetic sequence was isolated from Chlamydomonas cDNA using PCR with the Q5 DNA Polymerase (NEB, M0491L). The resulting fragment and the pChlamy4 plasmid (Thermofisher ...
-
bioRxiv - Plant Biology 2022Quote: Venus expression constructs were designed in SnapGene (v4.3.11) and generated by integrating PCR-amplified (Q5 hot start high-fidelity, #M0515, New England Biolabs) DNA fragments into plasmid pODC53 (Caspari ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic sequence of isolated clones at the target locus was further confirmed by PCR cloning (E#1202S, NEB) and Sanger sequencing (Australian Genome Research Facility ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products (90 bp) were spin-purified and 300 ng was digested with BsaI-HF-v2 (NEB R3733) in a 100 µl reaction for 2 h at 37°C (no heat kill ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB #M0530L), restriction enzymes (NEB) ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x 10 µl Phusion® High Fidelity PCR master Mix with HF buffer (Biolabs new England M0531S). The thermocycler program was 94 °C for 30 sec ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1-ABDTL was generated via PCR from pcDNA3.1-ABDTS and inserted into pcDNA3.1 via BamHI-HF (Cat #: R3136S; NEB)/EcoRI-HF (Cat # ...
-
bioRxiv - Microbiology 2024Quote: ... TAP-PCR was performed in a total volume of 25 μL containing 0.25 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... and IpgD were constructed using site-directed mutagenesis by PCR amplification using Q5 DNA polymerase (NEB; Table S4).
-
bioRxiv - Molecular Biology 2024Quote: ... All PCR amplifications for plasmid and vector constructions were performed using Q5 polymerase (New England Biolabs, Ipswich, MA). Most PCR reactions were performed using the following conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... All PCR amplification for plasmid and vector constructions were performed using Q5 polymerase (New England Biolabs, Ipswich, MA). Most PCR reactions were performed using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... The two PCR products were extracted and assembled using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The assembly product was transformed into E ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA lysate was used as genotyping PCR template with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and enhancer specific genotyping primer pair spanning the upstream and downstream Cas9-guide RNA cleavage sites (Table S19) ...
-
Microsatellite break-induced replication generates highly mutagenized extrachromosomal circular DNAsbioRxiv - Molecular Biology 2024Quote: ... Inverse PCR (iPCR) was performed on undigested total genomic DNA using Q5 HotStart polymerase (New England Biolabs, M0494S). The primers used for amplification are shown in Supplementary Table 2 ...
-
bioRxiv - Immunology 2024Quote: ... we amplified the targeted gene regions by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers (Supplementary Table 2 ...
-
bioRxiv - Biophysics 2024Quote: ... dsDNA templates were prepared by PCR amplification of WT_bPTC and Sh_bPTC ssDNA oligos using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR reactions were performed utilizing the Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs). Plasmids were sanger-sequenced to confirm the presence of all inserts ...
-
bioRxiv - Developmental Biology 2024Quote: ... the rbm8a wild type allele was genotyped by restriction digest of the PCR product with Xmn1 (R0194S, NEB) and the rbm8aΔ3 allele by Hinf1 (R0155S ...
-
bioRxiv - Genomics 2024Quote: ... Target loci were amplified from purified gDNA by PCR using NEBNext Ultra II Q5 Master Mix (#M0544X, NEB). Adapters for dual-indexed Illumina sequencing were attached in a second PCR step ...
-
bioRxiv - Genomics 2024Quote: ... The target locus was amplified from gDNA by PCR using NEBNext Ultra II Q5 Master Mix (#M0544L, NEB). Adapters for dual-indexed Illumina sequencing were attached in a second PCR step ...
-
bioRxiv - Immunology 2024Quote: ... pUltra-Hot-ZFAND6 was generated by subcloning a ZFAND6 PCR product digested with Xba1 (New England Biolabs; R0145S) and BamH1-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR products were amplified using Q5-High Fidelity DNA polymerase according to the manufacturer (New England Biolabs).
-
bioRxiv - Cell Biology 2024Quote: ... Ligation of the PCR product with the purified destination vector was performed using T4 DNA Ligase (M0202S - NEB) and transformed in Stbl3 bacteria ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting PCR products then underwent end-repair and A-tail addition followed by New England Biolabs (NEB) adapter ligation ...
-
bioRxiv - Genetics 2023Quote: ... Semi-quantitative PCR was performed using Taq DNA polymerase with standard Taq buffer (New England BioLabs Cat # M0273S). PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were amplified using a 12 cycle PCR with NEBNext® Multiplex Oligos for Illumina protocol (NEB) and a standard Phusion polymerase protocol (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were conducted using the Q5® High-Fidelity DNA polymerase system (New England BioLabs, Ipswich, MA); 5 μL 5X Q5 Reaction Buffer,0.25 μL Q5 High Fidelity DNA Polymerase ...