Labshake search
Citations for New England Biolabs :
5551 - 5600 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... PCR reactions were carried out using Q5 High Fidelity Hot Start DNA Polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions (15 μL) contained 7.5 μL of 2X OneTaq 2X Master Mix with Standard Buffer (NEB), 5.9 μL H2O ...
-
bioRxiv - Genetics 2023Quote: Next-generation sequencing (NGS) amplicons were prepared by PCR amplification using Q5 High-Fidelity DNA Polymerase (NEB). 250 ng of template DNA was amplified in 15 cycles during the PCR1 step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All PCR reactions were performed using Q5 High-Fidelity master mix (New England Biolabs, Ipswich, Massachusetts, USA). For the first stage PCR ...
-
bioRxiv - Genetics 2022Quote: ... genomic target sites were PCR-amplified (Q5® Hot Start High-Fidelity DNA Polymerase, New England Biolabs) using primers encoding Illumina adapter sequences (Supplementary Table 4) ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... Genes of interest were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs #M0491L). All genes were inserted into either pLV-Ef1a-V5-LIC-IRES-PURO (Addgene #120247 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were digested with DpnI and assembled with Gibson assembly master mix (New England Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µl of purified PCR product was used in a 20 µl HiFi assembly reaction (NEB, E2621S). HiFi assembly was performed at 50°C for 1 hour.
-
bioRxiv - Immunology 2022Quote: ... A first round of PCR was performed using 1× Standard-Taq magnesium free reaction buffer pack (NEB) with 2 mM MgCl2 (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and various PCR-amplified inserts were then added via Gibson Assembly (New England BioLabs Cat. No. E2611.) To generate pAw-Gal4DBD-3×127D01 ...
-
bioRxiv - Genetics 2023Quote: ... and amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs; M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Biophysics 2023Quote: ... All DNA fragments were generated by PCR using Q5 Hot Start High-Fidelity DNA polymerase (NEB # M0494S). The primers for each fragment had gene-specific 3’- sequences and 15–20 additional bases at the 5’ end that overlap with the ends of the adjacent fragment ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... hassiacum strain DSM 44199 as a template for colony-PCR with Q5 High-Fidelity DNA polymerase (NEB) to generate a fragment cloned into initial vector pINIT (Cm25) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed using the high-fidelity polymerase Q5 (New England Biolabs - NEB M0492 or M0493) and purified using a DNA clean and concentrate kit (Zymo Research #D4014) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in two stages of Polymerase Chain Reaction (PCR) using Q5 DNA polymerase (NEB). For the first PCR reaction ...
-
bioRxiv - Genomics 2023Quote: ... PCR master mix (64 µL of H2O, 100 µL of Q5 high-fidelity DNA polymerase (NEB #M0544S), 8 µL of i5 primer ...
-
bioRxiv - Neuroscience 2023Quote: ... After quantification of individual libraries by q-PCR using the NEBNext library quant kit (New England BioLabs), all the samples were pooled in an equimolar manner ...
-
bioRxiv - Plant Biology 2024Quote: ... and the genes were PCR-amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: Point mutants were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs) or Herculase II (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... in a thermal cycler with a 2 × Q5 PCR master mix (New England Biolabs, Ipswich, MA, USA). The following program was used ...
-
bioRxiv - Genomics 2023Quote: ... Real-time polymerase chain reaction (PCR) was performed using Luna® Universal qPCR Master Mix (NEB M3003L) and the Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad 1845097) ...
-
bioRxiv - Biophysics 2023Quote: ... The PCR product was spin column purified and then digested with BssSI-v2 and PpuMI (NEB R0560) in order to form the 6,481 bp center segment with 4 or 3 bp overhangs on the ends ...
-
bioRxiv - Bioengineering 2023Quote: ... The inverse PCR protocol was adapted from an established protocol (56) utilizing Sau3AI (New England Biolabs®) and HinP1I (New England Biolabs® ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids with correct fragment size were amplified by PCR using Q5® High-Fidelity DNA polymerase (NEB) and integration site flanks (50 base pair homologous region ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs). Positive candidates were sequenced to identify and confirm indels (Figure S6).
-
bioRxiv - Immunology 2023Quote: ... The PCR thermal conditions were conducted using Q5® High-Fidelity DNA Polymerase (New England Biolabs, USA) at two step-PCR 98 °C 30 sec ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic PCR was carried out using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S) to amply Mir96 loci ...
-
bioRxiv - Neuroscience 2023Quote: ... 72°C – 1 min]) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.5 % Tween-20 and the selected genes amplified by PCR using Q5® Hot Start polymerase (NEB) using forward primer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR reactions were performed with Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions and products were run on a 1% agarose gel alongside an appropriately sized ladder (either New England Biolabs 100 bp or 1kb DNA ladder ...
-
bioRxiv - Plant Biology 2024Quote: ... the respective promoter was isolated via PCR using Phusion High Fidelity Enzyme (New England Biolabs, no. M0530L) and inserted upstream of GUS gene of pCambia1301 vectors ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reactions were purified using GeneAid and ∼100 ng of DNA subjected to digestion by NaeI (NEB). Clones that showed no apparent digestion product (due to the modification of the NaeI restriction site ...
-
bioRxiv - Genetics 2024Quote: ... Each of the six mutant segments were amplified from the oligonucleotide pool by PCR (Q5, NEB #M0491L), gel purified (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Genetics 2024Quote: ... PCR samples were combined with 1 μL of 6X gel loading dye (New England Biolabs, Cat. # B7024S) per 5 μL of sample and loaded each the remaining wells ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR reactions were cleaned up using NEBNext sample purification beads (New England Biolabs GmbH, Frankfurt, Germany). Concentration of the libraries was determined by Qubit using the Qubit dsDNA HS Assay Kit (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the barcode and sensor regions of the biosensor libraries were amplified using Q5 PCR (New England Biolabs) directly off 5 μL of glycerol stock using primers p117 and p118 (Table 2) ...
-
bioRxiv - Biophysics 2024Quote: ... A 673 bp digoxigenin-labeled DNA handle was amplified in Q5U PCR master mix (NEB, Cat# M0597L) with a forward primer containing a deoxyuridine and a reverse primer with a 5′ digoxigenin tag ...
-
bioRxiv - Cell Biology 2024Quote: ... Both amplicons were generated through PCR with Q5 Hot Start High-Fidelity 2X Master Mix (NEB #M0494) using primers listed in Table S2 ...
-
bioRxiv - Genomics 2024Quote: ... and used as a template for a two-step PCR with Phusion High-Fidelity DNA polymerase (NEB) and primers in Supplementary Table 7 ...
-
bioRxiv - Immunology 2024Quote: ... The qRT-PCR assays was performed using Luna Universal qPCR Master Mix (New England BioLabs, Frankfurt, Germany) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exon 3 of Smad4 was amplified by PCR using the Q5 High Fidelity DNA polymerase (M0491S; NEB). Smad4 primers used were FWD ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids with various mutations were generated by PCR methods using Q5® Site-Directed Mutagenesis Kit (NEB) according to the instructions and verified by Sangon ...
-
bioRxiv - Bioengineering 2024Quote: Primers were synthesized by Thermo Scientific and routine PCR amplifications were carried out using Phusion High Fidelity DNA Polymerase (New England Biolabs, UK). Chromosomal modifications were engineered in A ...
-
bioRxiv - Biochemistry 2024Quote: Cy3-labeled enhancer-promoter DNAs used for condensation assay were generated by PCR using Taq polymerase (NEB) with a Cy3-labeled primer (IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... the pSEVA plasmid was amplified by PCR using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the Fwd_GFP_rep_AN (ATGCGTAAAGGAGAAGAACTTTTCAC ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was amplified by PCR in 25 μL reactions using Q5® High-Fidelity DNA Polymerase (NEB). All PCR reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Resulting cDNA was amplified by 19 PCR cycles using LongAmp Hot Start Taq 2X Master Mix (NEB). RT and PCR primers were used as previously described (Rabani ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... PCR reactions to amplify sgRNA and CaCas9 were carried out using Phusion High-Fidelity DNA polymerase (NEB), and Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...