Labshake search
Citations for New England Biolabs :
5801 - 5850 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... MYH7 fragment containing mutation was amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491L) and 500 nM forward and reverse primers (Table 3) ...
-
bioRxiv - Genetics 2023Quote: ... Semi-quantitative PCR was performed using Taq DNA polymerase with standard Taq buffer (New England BioLabs Cat # M0273S). PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were amplified using a 12 cycle PCR with NEBNext® Multiplex Oligos for Illumina protocol (NEB) and a standard Phusion polymerase protocol (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were conducted using the Q5® High-Fidelity DNA polymerase system (New England BioLabs, Ipswich, MA); 5 μL 5X Q5 Reaction Buffer,0.25 μL Q5 High Fidelity DNA Polymerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis of DmelOrco was done by PCR with the Q5® site directed mutagenesis kit (NEB) using primers optimized with the NEBase Changer online tool and following the supplier’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were digested using ClaI and BamHI in 1X Cutsmart buffer (New England Biolabs, Ipswich, MA) and ligated into the pCW57 backbone using T4 DNA ligase ...
-
bioRxiv - Biophysics 2023Quote: ... In the first reaction we made a PCR-fragment with Q5 DNA polymerase (M0491, New England Biolabs, UK) using primers JT403 (CCTGTAGTCTTCTTAATTAAGACGTCAG ...
-
bioRxiv - Microbiology 2023Quote: ... The 720 bp lpxE gene was amplified by PCR from pUC57::lpxE using Q5 polymerase (New England Biolabs) and primer set lpxE-F/lpxE-R ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mRNA expression was quantified by qRT-PCR using 2X Luna Universal qPCR Master Mix (New England Biolabs) on a QuantStudio 3 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... the products of PCR1 were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, no. T1030L) and deep sequenced at the MGH DNA Core ...
-
bioRxiv - Cell Biology 2023Quote: ... treating each well with 100 μl of lysis buffer (0.45% NP40, 0.45% Tween20, 0.5x NEB Q5 PCR buffer, 0.1 mg/mL NEB Proteinase K) were incubated for 10 min at 55°C in and subsequently heated to 95°C for 10 min to inactivate the proteinase K ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified PCR products were ligated using the HiFi DNA Assembly master mix (New England Biolabs, catalog no. E2621S) into a Blasticidin-resistance encoding lentiviral vector (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... were amplified by polymerase chain reaction (PCR) with the Phusion High-fidelity DNA Polymerase (New England Biolabs #M0530L), then both amplicons were assembled by Gibson assembly to produce the desired CRISPRoff-mScarletI plasmid.
-
bioRxiv - Molecular Biology 2023Quote: ... and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs). Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR-amplified ampR/PampC and luxCDABE sequences were cloned into pUC19 by HiFi assembly (New England BioLabs). Next ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... index groups and Illumina sequencing adapters were added by performing 11 PCR cycles with Phusion DNA Polymerase (NEB). We multiplexed the samples in several index groups (19 and 20 individuals each) ...
-
bioRxiv - Microbiology 2023Quote: ... This was then used to amplify the DrpA cDNA by PCR with the Q5 polymerase (New England BioLabs) and primers ML 4417/4418 ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified after agarose gel electrophoresis using the Monarch DNA Gel Extraction Kit (New England Biolabs) and submitted for Sanger sequencing to Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Constructs for plasmid-based expression of genes were generated using PCR and Gibson Assembly® (NEB, Boston, MA) followed by cloning into pMQ72 ...
-
bioRxiv - Genetics 2023Quote: ... Pooled DNA libraries were amplified in 50 µl reactions with 1x NEBNext High Fidelity PCR Master Mix (NEB) and 12.5 pmol PCR primers containing complementary sequences for adapter-ligated DNA ...
-
bioRxiv - Microbiology 2023Quote: ... and hpr were PCR amplified from the JKD6008 gDNA using Phusion Hot Start Flex Polymerase (New England Biolabs) with primers that incorporate the BgIII and EcoRV restriction sites at the 5’ and 3’ ends ...
-
bioRxiv - Genetics 2023Quote: ... Combining long homology fragments with selective markers was made by overlapping PCR or Gibbson cloning (Cat# E5520S, NEB). Oligonucleotides are listed in Table S2 ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and coding sequences were commercially synthesized (Eurofins) or PCR-amplified using the Q5 high fidelity polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence corresponding to residues 1-239 was amplified by PCR using Q5 High-Fidelity DNA Polymerase (NEB), cut with restriction enzymes NdeI (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... was obtained and PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs, Catalog #M0493S) from position 376-1125 ...
-
bioRxiv - Genomics 2023Quote: Libraries were prepared by combining transposed DNA with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... ERK7-BioID2-3xHA was created by transfecting the RHΔku80Δhxgprt strain (66) with 50 μL of a PCR product using Q5 polymerase (NEB) with 500 bp homology arms flanking a BioID2-3xHA tag together with 5 μg of a Cas9 plasmid that had been modified to express HXGPRT and also a gRNA targeting the C-terminus of ERK7 (37) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA or genomic sequence of each gene was amplified by Phusion High-Fidelity PCR kit (New England BioLabs), cloned to pDonor 221 ...
-
bioRxiv - Cancer Biology 2023Quote: ... JH4 intron sequences were amplified from genomic DNA by PCR with Phusion High-Fidelity DNA polymerase (NEB; M0530S) using JH4 forward primer and JH4 reverse primer ...
-
bioRxiv - Genetics 2023Quote: ... All PCR amplifications for plasmid and vector constructions were performed using Q5 polymerase (New England Biolabs, Ipswich, MA). Most PCR reactions were performed using the following conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... Polymerase chain reactions (PCRs) were conducted with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA), PCR purifications with the Monarch® PCR & DNA cleanup kit (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... VK7 cDNA was used as template for PCR amplification using Phusion High-Fidelity DNA Polymerase (New England Biolabs), following manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... The PCR was performed in a total volume of 50 µl containing 1× HF buffer (New England BioLabs), 1 µl dNTP Mix (New England BioLabs) ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Microbiology 2023Quote: ... Purified PCR products were incubated together in a thermocycler with 1X Hi-Fi DNA Assembly master mix (NEB) at 50°C for one hour ...
-
bioRxiv - Genomics 2023Quote: ... was subcloned into the pIRES2-dsRED2 plasmid using PCR with ag409 and ag410 and NotI restriction digestion (NEB) to create KCNE1-HA:pIRES2:dsRED2 ...
-
bioRxiv - Immunology 2023Quote: ... PCR enrichment of adaptor-ligated DNA was performed using NEBext Multiplex Oligos for Ilumina (NEB #E7335S and #E7500S) following the recommended number of amplification cycles based on the amount of cDNA input used in the fragmentation/end prep reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... Amplified PCR products with appropriate expected sizes were purified with the Monarch® DNA Gel Extraction Kit (NEB). Purified PCR products were cloned into the pMiniT 2.0 vector (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Hep3B cells and HBV control HepG2 2.2.15 cells and subjected to PCR amplification using the LongAmp Taq kit (NEB) and HBV primers spanning the CTCF binding motifs (HBV2 forward and Hep23B reverse) ...
-
bioRxiv - Systems Biology 2023Quote: ... with 1.5 µg undigested genomic DNA per PCR reaction using Q5 HotStart High Fidelity Polymerase (New England Biolabs). Resulting PCR product from multiple reactions per sample were pooled ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1-ABDTL was generated via PCR from pcDNA3.1-ABDTS and inserted into pcDNA3.1 via BamHI-HF (Cat #: R3136S; NEB)/EcoRI-HF (Cat # ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products (90 bp) were spin-purified and 300 ng was digested with BsaI-HF-v2 (NEB R3733) in a 100 µl reaction for 2 h at 37°C (no heat kill ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid cloning was performed primarily using standard PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB #M0530L), restriction enzymes (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid backbones without eYFP were amplified by PCR with PR41 and PR42 using Q5 Polymerase (New England Biolabs) and pAJM657 ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli in vitro transcription were synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... Libraries were PCR amplified in 8x 50ul reactions per 10,000 gRNAs (0.5 µl Q5 polymerase (NEB Cat #M0493), 10 µl 5× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Templates for in vitro transcription were generated by PCR amplification (Q5 High-Fidelity DNA Polymerase, New England Biolabs) from plasmids using a T7 extended primer (5’-CCTAATACGACTCACTATAGGGAG-3’ 85) ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA library was then prepared for Illumina NGS sequencing by PCR using Phusion HF master mix (NEB) and custom indexed primers for the PTM library 56 ...