Labshake search
Citations for New England Biolabs :
5951 - 6000 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 2 ul of cDNA without dilution was used for each PCR reaction by Phusion® HighFidelity DNA Polymerase (NEB) for 35 cycles ...
-
bioRxiv - Synthetic Biology 2022Quote: ... in which 20-50 ng of uncut acceptor plasmid and a 2:1 molar ratio of donor plasmid or PCR products were mixed together with 1.5 μl DNA T4 ligase buffer (#B0202S; NEB), 0.0015 mg BSA (B9000S ...
-
bioRxiv - Genomics 2022Quote: The library for high-throughput sequencing was prepared in a two-step PCR (Q5 high-fidelity DNA polymerase, NEB). In PCR1 ...
-
bioRxiv - Immunology 2022Quote: ... and three fragments covering the full-length genome were synthesized with high-fidelity Phusion HiFi PCR Master Mix (NEB,) using specific primers as shown by Yang et al ...
-
bioRxiv - Microbiology 2022Quote: ... the transposon–genome junctions were enriched by PCR and indexed using NEBNext Multiplex Oligos (NEB #E7600S, New England Biolabs). The libraries were quantified by the University of Michigan Advanced Genomics Core using the Agilent TapeStation system (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... the transposon–genome junctions were enriched by PCR and indexed using NEBNext Multiplex Oligos (NEB #E7600S, New England Biolabs). The libraries were quantified by the University of Michigan Advanced Genomics Core using the Agilent TapeStation system (Agilent ...
-
bioRxiv - Bioengineering 2022Quote: ... Templates for IVT were generated by performing high-fidelity PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) and primers 1 and 2 (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... The gel-purified PCR products were assembled together using NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... We cleaned the samples and inputs using the Monarch PCR & DNA clean-up kit (New England BioLabs, Ipswich, MA), prepared libraries using the ThruPLEX DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Neuroscience 2020Quote: ... splice acceptor-T2A-LexA:QF fragments for all three intron phases were amplified by PCR (Q5 polymerase, New England Biolabs) from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947 ...
-
bioRxiv - Genomics 2021Quote: ... We amplified libraries by adding 10 ul DNA to 25 ul NEBNext HiFi 2x PCR mix (New England Biolabs) and 2.5 ul of a 25 uM solution of each of the Ad1 and Ad2 primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... standard PCR reactions were performed on 1 ul of cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and each of the variant PCR primer pairs independently ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplifications were carried out using high fidelity Phusion polymerase or Taq DNA polymerase (both from New England Biolabs). Electroporation of C ...
-
bioRxiv - Molecular Biology 2020Quote: ... All PCRs for library preparation were carried out using Q5 High-Fidelity 2X Master Mix (NEB, Cat. No. M0492L). An initial enrichment amplification of 15 cycles was followed with a second round of PCR using unique P5 and P7 indexing primer combinations for 15 cycles and purified using 1.8X SPRI beads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Templates for in vitro transcription were generated by PCR-amplification using Q5 Polymerase (New England Biolabs, Cat No. M0491S).
-
bioRxiv - Microbiology 2021Quote: ... Transformants positive for each Cas9HygAMA-sgRNA plasmid were screened by colony PCR using Taq DNA polymerase (New England Biolabs) with the forward Cas9HygAMAccdB primer (MR139 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the Schizosaccharomyces pombe rad9 intron was synthesized via fusion PCR (4) and inserted between BamHI and PstI (NEB). The N ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... with the exception of a 0.9 kb region containing bla was PCR amplified and joined via Gibson assembly (HiFi DNA Assembly, New England Biolabs) with a 1.3 kb PCR product containing kan PCR amplified from pCM66 [57] to generate pPS04 (Fig S2) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA across the samples was normalised and specific transcripts amplified using Phusion® high-fidelity PCR master mix (NEB) with primers outlined in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... identified from UniProt (https://www.uniprot.org/) were then PCR amplified and inserted into the vector backbone through NEB HiFi Assembly (New England Biolabs, #E2621). Each optogenetic receptor was then subsequently inserted into a second-generation lentiviral shuttle doxycycline inducible vector through NEB HiFi Assembly ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR products (521 bp) were then treated with the restriction enzyme Bsp1286I (New England Biolabs, Ipswich, MA, USA), and the F54L mutant DNA was digested to 260 bp and 261 bp fragments ...
-
bioRxiv - Microbiology 2021Quote: ... First-round PCR of 14 cycles was performed using Q5 High-Fidelity Master Mix (New England BioLabs, Ipswich, MA) and nested gene-specific primers at 20 μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... and genome-integrated sgRNA sequences were amplified by PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs). i5 and i7 multiplexing barcodes were added in a second round of PCR and final gel-purified products were sequenced on an Illumina NextSeq500 system at the LTRI NBCC facility (https://nbcc.lunenfeld.ca/ ...
-
bioRxiv - Neuroscience 2020Quote: ... primers were designed using NEBuilder Assembly Tool (v1.12.18) to generate overlapping (20-25 bps) PCR fragments amplified using Q5® High-Fidelity DNA Polymerase (NEB). Modified TALE constructs were created using PCR fragments amplified from pAAV-CW3SL-EGFP (Addgene # 61463) ...
-
bioRxiv - Synthetic Biology 2021Quote: All PCR reactions for cloning purposes were performed using Q5® High Fidelity 2X Master Mix (New England Biolabs). The reactions mixtures were prepared using 1 ng of template ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were assembled by Gibson assembly using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, USA).
-
bioRxiv - Microbiology 2022Quote: ... Digested pAd5-Blue and IE1 PCR products were then ligated using T4 DNA ligase (New England Biolabs, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: PCR-amplified parts of DNA were assembled using Golden Gate Assembly and inserted into plasmid backbones (New England Biolabs).49 The T7 driven gene circuits for fusion protein expression were inserted into vector PBS1C,50 which carries homology sites of amyE locus and a chloramphenicol resistance selection marker ...
-
bioRxiv - Genomics 2022Quote: ... Two nested single-tail adapter/tag (STAT)-PCR [29] were performed with LongAmp Hot Start Taq polymerase (NEB, M0533S) using adaptor binding P5_1 and P5_2 primers and corresponding insert primer pairs (see Supplementary Table 2) ...
-
bioRxiv - Genetics 2022Quote: ... The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs, catalog number M0202). This plasmid was named pBSMVγQT1 (Figure 1b) ...
-
bioRxiv - Microbiology 2022Quote: ... and the fucI PCR product was cloned into the plasmid using the NEBuilder HiFi DNA Assembly Kit (NEB; E5520S), followed by transformation into the E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were eluted in 20 μL of elution buffer and PCR-amplified using the NEBNext 2X Master Mix (NEB) for 11 cycles and sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Microbiology 2019Quote: ... Putative T3SS effector genes were PCR amplified from Aeromonas genomic DNA using Phusion DNA polymerase (New England Biolabs; NEB) and appropriate primers ...
-
bioRxiv - Microbiology 2019Quote: ... Putative T3SS effector genes were PCR amplified from Aeromonas genomic DNA using Phusion DNA polymerase (New England Biolabs; NEB) and appropriate primers ...
-
bioRxiv - Microbiology 2019Quote: ... The reverse transcription was followed by PCR amplifications using the Q5® high-fidelity DNA polymerase (New England Biolabs) with primers amplifying two overlapping fragments per RNA segment ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 μL 12.5% Triton-X to each well to quench the SDS and 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified for 12 cycles (72 °C 5 min ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed with a oligonucleotide concentration of 300 nM using the Luna Universal qPCR Master Mix (NEB). The results were analyzed using the Applied Biosystems 7500 Fast Real-Time PCR Software v2.3 (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Genotyping was performed by agarose gel electrophoresis-mediated detection following PCR reaction by Taq polymerase (M0273, New England Biolabs). qPCR was performed using GoTaq® qPCR Master Mix (A6001 ...
-
bioRxiv - Genomics 2019Quote: ... The reverse transcribed samples were subjected to PCR for 15 cycles by adding 50μL of the PCR mastermix from the NEB small RNA for Illumina library prep kit (NEB), 5μL of the Universal adapter and 5μL of a unique indexed adapter (see NEB library pooling guidelines for suitable adapter combinations for three sample sequencing runs) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Genomic DNA templates were obtained from Muc14a fragments previously cloned in a pMiniT 2.0 vector using PCR Cloning Kit (NEB) and primers kmer Muc14_F and 58537687_F ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The resulting PCR fragments were re-assembled into pY2H-GFP digested with BssHII and NdeI using Gibson cloning (NEB) and confirmed by sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Locus-specific PCR was performed using the standard protocol for Q5 Hot Start Master Mix (New England BioLabs M094S). PCR was also performed on unedited DNA extracted from PGP1 iPSCs as a control for background.
-
bioRxiv - Microbiology 2020Quote: ... The resulting PCR product was cloned into pDC_A1G3 pre-digested with Sal I using Gibson Assembly master mix (NEB) according to the manufacturer’s instructions giving rise to plasmid pDC_A1G2/3.
-
bioRxiv - Cancer Biology 2019Quote: ... a 244 bp fragment of APOE was amplified using standard PCR and digested with Hhal (R0139S, New England Biolabs), and allele-specific products were resolved on a 15% polyacrylamide gel ...
-
bioRxiv - Pathology 2021Quote: ... Fragmented PCR products were repaired and dA-tailed using the NEBNext End Repair/dA Tailing kit (New England Biolabs) according to the manufacturer’s instructions and subsequently barcoded with Illumina-compatible ...
-
bioRxiv - Synthetic Biology 2021Quote: ... To this end pCANTAB6_VhhTD4 plasmid (Supplementary Fig. S2) was used as DNA template for PCR using Q5 DNA polymerase (NEB) in three different reactions each containing the oligos 1 and 2 (for H107Y) ...
-
bioRxiv - Synthetic Biology 2021Quote: Linear DNA templates for expression in IVTT reactions were created by PCR using Phusion High-Fidelity DNA Polymerase (NEB) with primers pBEST_LinL_F and pBEST_LinL_R (Table S1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genetics 2020Quote: ... Fragments were either PCR amplified with a least 15 bp overlap at each end (Phusion Hot Start Flex NEB M0535L ...