Labshake search
Citations for New England Biolabs :
5651 - 5700 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... Invitrogen Platinum™ SuperFi™ Green PCR Master Mix or Q5® High Fidelity Polymerase (New England Biolabs) were used for generation of backbones from p005 and p006 vectors (appendices ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The template was eliminated after the PCR reactions by addition of 1 µL DpnI (10,000 U/mL, NEB) to 25 µL PCR reactions and incubation at 37 °C for at least 1 h ...
-
bioRxiv - Systems Biology 2021Quote: ... Positive clones were confirmed by genotyping the respective locus by colony PCR using Q5 Polymerase (NEB, Ipswitch, MA) as described in the next section.
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Full plasmid sequences and descriptions of the individual cloning steps can be provided upon request ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: All PCR was performed using 0.02 U/μl Q5® High-Fidelity DNA Polymerase (New England Biolabs, US), 1x Q5® Reaction Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 100ng of each gDNA sample was PCR amplified in triplicate with Q5 High-Fidelity DNA Polymerase (NEB #M0494S) with 500nM primers (Supplemental table 4 ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was conducted in a total volume of 25 μl that contained 1X Q5 buffer (New England Biolabs), 0.25 μM of each primer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... elegans codon adaptor.[48] PCRs were carried out using Q5 2x Hot-Start Master Mix (New England Biolabs). PCR and digestion products were recovered from agarose gels following electrophoresis using the Zymogen Gel Recovery Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR product and pRRK plasmid were digested with the XBaI restriction endonuclease (New England Biolabs, Ipswich, MA). The digested plasmid was then incubated twice with Antarctic Phosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... Cloned genes (below) were used as template DNA for PCRs with Phusion polymerase (New England Biolabs, Ipswich, MA). Complete dsRNA synthesis protocols ...
-
bioRxiv - Biophysics 2020Quote: ... The three PCR generated fragments were assembled in the presence of pUC18 digested with NdeI and PstI (NEB) by Gibson Assembly according to the manufacturer specifications to create pUCΔF1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Alternative sgRNA sequences (Supplementary Table S2) were generated by PCR reactions with Q5-High-Fidelity DNA-polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... ATGTGGGCCCGGCACCTTAA were used to amplify the pool using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Genetics 2022Quote: ... The DNA was used as a template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs), following the manufacturer’s protocol ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: ... Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT ...
-
bioRxiv - Biophysics 2022Quote: ... Each PCR product was then run on an agarose gel and purified using a gel extraction protocol (NEB). The purified PCR product concentrations were measured using the Picogreen assay (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2022Quote: The gRNA entry vectors were constructed by PCR amplification with Q5 High-Fidelity DNA polymerase (New England Biolabs) of the entire pGG-[B-F]-OsU3-BbsI-ccdB-BbsI-[C-G] plasmids according to the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using 100 ng of genomic DNA and Q5 High-Fidelity Taq Polymerase (New England Biolabs) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ~500 bp sequences flanking the fadX gene (SAUSA300_0229) were amplified by PCR using Q5 DNA Polymerase (NEB M0491L). For cloning purposes ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was used as template in PCR reactions containing the Taq 2X Master Mix (New England Biolabs) and 5 μM of MP2- and scorpine-specific primers (Table S7) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification was carried out by using Phusion® High-Fidelity DNA polymerase from New England Biolabs (NEB) on a T100TM Thermal cycler from Bio-Rad and the primer pairs listed in Supplementary Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... the regions of interest were amplified and barcoded using nested PCR with Phusion High-Fidelity DNA Polymerase (NEB), an internal primer containing TSA7 and a footprint sequence ~100-150 nt from the predicted end (oHR542/543/544/545 ...
-
bioRxiv - Microbiology 2021Quote: ... Consistently incomplete assemblies or local ambiguities were solved by PCR amplification using the high-fidelity polymerase Phusion (NEB) followed by Sanger Sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR-amplified insert and the vector backbone were each cut with appropriate restriction enzymes (New England Biolabs). After dephosphorylation of the backbone (using FastAP dephosphorylase ...
-
bioRxiv - Developmental Biology 2021Quote: ATAC-seq library was amplified from 20μl tagmented DNA with 25μl 2x Phusion PCR master mix (NEB, 28006) and 0.625μl of each 100mM library primers ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR products were separated on agarose gels and purified for Sanger Sequencing (Microsynth) using ExoSAP-IT reagent (NEB). Chimeric PCR products were subcloned before sequencing using StrataClone PCR cloning kits (Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB, Cat number M0530L) or the Platinum SuperFi DNA polymerase from ThermoFisher (Cat number 123551010 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR product and the new AT1.03 and AT1.03R122KR126K in pDRF1-GW were digested with EcoRI (New England Biolabs) and NotI ...
-
bioRxiv - Immunology 2020Quote: ... The digested PCR fragment and pGEM-4Z vector were then ligated using T4 DNA ligase (New England Biolabs) per manufacturer instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR products were purified and then digested using NotI and ApaI restriction enzymes (NEB, Ipswich, MA, USA). The modified OR sequences were separated by gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Neuroscience 2020Quote: ... The purified PCR product and the linearized backbone were assembled using Gibson assembly (New England Biolabs, Ipswich, MA). DNA was transformed into Stable competent cells (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... The popZ insert and the plasmid PCR product were assembled together using the Hifi DNA assembly mix (NEB). The construction was verified by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... For all PCR reactions the Q5 Hot Start High fidelity DNA polymerase was used (New England Biolabs Inc.), according to the manufacturer’s instructions and adapting the elongation time to the size of the amplicon ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification was performed using the Q5® Hot Start High-Fidelity DNA Polymerase (New England BioLabs Inc.) and the corresponding protocol28 with an annealing temperature of 66°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting cDNA was then further amplified through nested PCR using Phusion 2X Hot Start Flex MasterMix (NEB), as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were prepared as described above used as DNA template for PCR amplification using Phusion polymerase (NEB) and oligonucleotides that anneal 150 bp outside of wzc ...
-
bioRxiv - Microbiology 2022Quote: ... The synthesized ssDNA was purified using a Monarch PCR & DNA Cleanup Kit (New England Biolabs, Ipswich, MA, USA) and was eluted in ultrapure water ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplified fragments to be used for recombineering were produced with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Genetics 2022Quote: ... PCR-products were gel purified after agarose gel electrophoresis with Monarch DNA Gel Extraction Kit (New England Biolabs) and submitted for sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions for molecular cloning was carried out using Q5® High-Fidelity DNA Polymerase (NEB, M0491) while colony PCR was carried out using Taq Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... end-point PCR assays were carried out with Hot Start Taq 2X Master Mix (New England Biolabs, USA) in a 20 μL reaction mixture containing 0.5 units of taq polymerase ...