Labshake search
Citations for New England Biolabs :
5751 - 5800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... by golden gate assembly using BbsI-HF and T4 ligase (both NEB). A donor plasmid for Ikzf1-mNeonGreen KI was generated by incorporating the mNeonGreen sequence ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μl of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of the RNA were sent to Azenta Life Sciences for genome-wide mRNA sequencing using NEBNext Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA) for NovaSeq (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cloning strains used were NEB Stable (lentiviral) (New England Biolabs). Final constructs were validated by Sanger sequencing (Azenta/Genewiz).
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was clarified by centrifugation at 100,000 × g for 30 min and incubated with amylose affinity resin (New England BioLabs). Resin was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cole) containing an N-terminal 6×His-tag using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). The LSD1 constructs were expressed in BL21-CodonPlus (DE3)-RIPL competent E ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was clarified by centrifugation at 100,000 × g for 30 min and incubated with amylose affinity resin (New England BioLabs). Resin was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEB HiFi assembly kit (New England Biolabs) was used to clone the gene fragment into a pET29b expression vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs encoding BE3 or SsCBE2-C2 were linearized using the PmeI restriction enzyme (NEW ENGLAND BioLabs). mRNAs of base editors and gRNA were synthesized in vitro from linearized DNA templates using the mMESSAGE mMACHINE T7 Ultra kit (Ambion ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons were then cloned into the wild-type SsCBE-UGI-C2 vector using Gibson Assembly Master Mix (New England Biolabs). The cjSsCBE2 was constructed by exchanging APOBEC1 domain of cjCBEmax to SsdAtox-SRE domain ...
-
bioRxiv - Molecular Biology 2024Quote: 50-100 ng of purified PCR product was prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 10 µg Monarch RNA Cleanup Column (New England Biolabs) and eluted in 42 µl of nuclease-free water.
-
bioRxiv - Molecular Biology 2024Quote: 175-225 ng of purified PCR product was prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNased RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer ACAATTCGTCTTAAGGAATTTACCAATACACGCAA (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 50 µg Monarch RNA Cleanup Column (New England Biolabs), eluted in 20 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 10 µg Monarch RNA Cleanup Column (New England Biolabs) and eluted in 10 µl of nuclease-free water.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was carried out on 200-300 ng of restricted genomic DNA using OneTaq 2X Master Mix (NEB) with primers complementary to sequences within the neo cassette that flanked the intron [Neotet1s ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µl of RNase H Buffer (New England Biolabs) was added and incubated at 45°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: NEBNext® End Repair Module (NEB, E6050S) was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Molecular Biology 2024Quote: ... the samples were treated with 500 units RNase If for 20 minutes at 30°C (NEB cat# M0243S).
-
bioRxiv - Molecular Biology 2024Quote: ... along with the low range ssRNA ladder (New England Biolabs, cat# N0364S), were used to guide size-fractionation ...
-
bioRxiv - Molecular Biology 2024Quote: The pAAV plasmids generated in this study were produced by Gibson assembly using NEBuilder® HiFi DNA Assembly Master Mix (NEB, E2621S). The AAV-HR for in vitro studies in HEPA1-6 cells was obtained by replacing the hFIX gene5 with the firefly luciferase (Fluc ...
-
bioRxiv - Microbiology 2024Quote: ... high molecular weight (HMW) DNA was extracted from an overnight culture using the Monarch HMW DNA Extraction Kit for Tissue (New England Biolabs, Ipswich, MA, USA) as per manufacturer’s protocol for HMW DNA extracted from bacteria ...
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids were cloned by Gibson Assembly using NEBuilder HiFi (New England Biolabs). Cloning strains used were NEB Stable (lentiviral ...
-
bioRxiv - Molecular Biology 2024Quote: ... elution and treatment with RNAse A (ThermoScientific # EN0531) and Proteinase K (NEB # P8107S) overnight at 65°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 40 µL volume of elution was used as a template for restriction with KasI enzyme (NEB) at 37°C for 60 min followed by 20 min at 65°C to obtain two distinct modules (A and B) ...
-
bioRxiv - Molecular Biology 2024Quote: ... pFastBac-NSUN2 and pFastBac-NSUN2-K190M vectors has been obtained by Gibson assembly methodology and Gibson Assembly Master Mix (NEB # E2611S). DNA sequences of recombinant plasmids have been determined by Sanger sequencing.
-
bioRxiv - Molecular Biology 2024Quote: Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with exclusion of the initial size selection and the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, E7300S). Small RNA PCR products were size selected on a 10% polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples have been incubated with 5U of RNAse H (NEB # M0297S) for 1h at 37°C
-
bioRxiv - Molecular Biology 2024Quote: 200 ng of pooled PCR product was prepared for sequencing using the NEB-Next Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Biochemistry 2024Quote: ... by T4 polynucleotide kinase (NEB) (Table S1) ...
-
bioRxiv - Bioengineering 2024Quote: ... The target genomic locus was amplified by PCR using Q5 Hot Start high-fidelity 2X master mix (NEB) and primers listed in Table S3 and purified by PureLink PCR purification kit (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... Initial studies were done in an alternate NEB® 5-alpha strain (New England Biolabs, Catalog # C2987H) where trpA and trpB were replaced with a chloramphenicol resistance cassette ...
-
bioRxiv - Bioengineering 2024Quote: Protein was expressed for in vitro assays in T7 Express cells (New England Biolabs, Catalog # C2566H) in 96-well deep-well plates using the pET22b(+ ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.25 μL Murine RNase Inhibitor (New England Biolabs, Cat# M0314), and 14.75 μL water ...
-
bioRxiv - Bioengineering 2024Quote: ... Q5 high-fidelity polymerase (New England Biolabs, Cat# M0491L) was used to amplify gene fragments and non-lentiviral backbone for cloning as well as genomic DNA for deep sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... coli DH10β (NEB) and M ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain ER2566 (NEB) harboring a deletion of clpP ...
-
bioRxiv - Biochemistry 2024Quote: ... the gdhA gene was amplified using Q5 Polymerase (NEB) and the primers (Table S5) ...
-
bioRxiv - Bioengineering 2024Quote: ... and cDNA libraries were generated by RT-PCR using the ProtoScript II cDNA Synthesis Kit (BioLabs) according to the manufacturers’ protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... the corresponding plasmid was transformed into T7 express cells (New England Biolabs) and grown overnight at 37°C in 5 mL of LB-medium ...
-
bioRxiv - Biochemistry 2024Quote: ... An Illumina-compatible library was prepared with NEB Ultra II DNA kit (NEB) and each library was shotgun sequenced with Illumina HiSeq3000 (2 x 150 bp ...
-
bioRxiv - Biochemistry 2024Quote: ... the HiFi Assembly Kit (NEB, #E2621) was utilized.
-
bioRxiv - Biochemistry 2024Quote: ... Then 2 μL 10x RNA ligation buffer (NEB), 0.2 μL 100 mM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... and indexed primers (NEB). All libraries were purified on a 3% low melting point agarose gel.