Labshake search
Citations for New England Biolabs :
5201 - 5250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... we generated RNA-seq libraries using the NEBNext Rrna Depletion Kit (New England Biolabs) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by second-strand synthesis using the Klenow Fragment of DNA polymerase (NEB) with primer FR20RV-12N at 10 pmol ...
-
bioRxiv - Biochemistry 2024Quote: ... the pSEVA plasmid was amplified by PCR using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the Fwd_GFP_rep_AN (ATGCGTAAAGGAGAAGAACTTTTCAC ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was prepared using M-MuLV-reverse transcriptase per the manufacturer’s instructions (NEB). qPCR was performed using PowerUp SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... Library preparation with indexing was performed by the University of Kansas Genome Sequencing core facility with NEB Next RNA Library kit (NEB). RNAseq was performed using an Illumina NextSeq2000 high-output system with paired-end reads of 50 bp ...
-
bioRxiv - Microbiology 2024Quote: Ubiquitination reactions containing recombinant GST-PKN1 were immunoprecipitated using protein G-conjugated magnetic beads (New England Biolabs). Beads were prepared by washing three times with IP wash buffer (PBS + 0.1% Tween-20) ...
-
bioRxiv - Neuroscience 2024Quote: ... and were subsequently incubated with the respective restriction enzyme (BioLabs) for 1.5 h at the specified temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... connected to the exposure chamber (NEB-MED H, Braintree Scientific, Inc.). 5 mL of 5 mg mL−1 LPS was used to induce the injury ...
-
bioRxiv - Bioengineering 2024Quote: ... non-cell-permeable CLIP-substrate (CLIP-SurfaceTM 647; Catalog #S9234, NEB) with final dilution of 1:100,000 was added and incubated at for 1 hour at 95% humidity ...
-
bioRxiv - Microbiology 2024Quote: Library preparation and sequencing were conducted using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina with dual index primers and ∼300 ng of DNA (NEB Inc.) on an automation platform (Biomeki5 ...
-
bioRxiv - Microbiology 2024Quote: ... and hrp2 terminator were seamlessly ligated into pSKA-001 vector using NEBuilder HiFi DNA Assembly Master Mix (NEB) and the intermediate fragment was cloned into pYCs-PbU6-hDHFR/yFCU-NS-p230p vector ...
-
bioRxiv - Bioengineering 2024Quote: ... PolyA selection and stranded RNA-seq library preparation were performed with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760; New England Biolabs). Then ...
-
bioRxiv - Biochemistry 2024Quote: ... Then In-column DNase I Treatment and RNA cleanup was done using the Monarch RNA Cleanup Kit (NEB). Then total RNA was sent to QB3-Berkeley Genomics facility at the University of California ...
-
bioRxiv - Bioengineering 2024Quote: ... WT and CD81-Snorkel-tag input EVs were labelled with CLIP-substrate (CLIP-SurfaceTM 647; Catalog #S9234, NEB and/or CLIP-SurfaceTM 488; Catalog #S9232, NEB) with final dilution of 1:100,000 was added and incubated at for 1 hour at 95% humidity ...
-
bioRxiv - Biochemistry 2024Quote: ... and Antarctic phosphatase (New England Biolabs) for dephosphorylation ...
-
bioRxiv - Biochemistry 2024Quote: ... calf intestinal phosphatase (New England Biolabs), and Antarctic phosphatase (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... coli (New England Biolabs). After transformation ...
-
bioRxiv - Genetics 2024Quote: ... using the T4 DNA Ligase (New England Biolabs) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: The MERSCOPE 500 gene imaging kit was activated by adding 250 μl of Imaging Buffer Activator (Vizgen, #203000015) and 100 μl of RNAse Inhibitor (New England BioLabs, M0314L). 15 ml of mineral oil was overlaid on top of the imaging buffer through the activation port ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Escherichia coli and Myxcococcus xanthus were amplified from genomic DNA by PCR (Q5® High-Fidelity 2X Master Mix, New England Biolabs, USA-MA) and introduced into the pLIC expression vector55 by Gibson cloning (Gibson Assembly Master Mix ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and introduced into the pLIC expression vector55 by Gibson cloning (Gibson Assembly Master Mix, New England Biolabs, USA-MA). All other extant and ancestral CS sequences were obtained as gene fragments from Twist Bioscience (USA-CA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... For single-site mutants and deletions of the CS-sequences the KLD Enzyme Mix (New England Biolabs, US-MA) was used ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs) and quantified using the Qubit Broad Range dsDNA kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Finally a gRNA targeting p230 were designed using EupaGDT and ligated using T4 ligase (New England Biolabs, Ipswich, MA, USA), resulting in the pYCs-PbU6-hDHFR/yFCU-NS-p230p plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... This DNA was subjected to 18 cycles of PCR using whole genome primers (ONT #SQK-PSK004) and LongAmp Hot Start Taq 2X Master Mix (NEB #M0533). Library preparation was done using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (NEB #E7645 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and joining SEGS-1F and SEGS-1G using the indicated primers in Supplementary Figure 1 and the Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA). All the primers except for those for site-directed mutagenesis added NotI restriction sites at the 5’ and 3’ends of PCR products ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NicE-view labeling mix was based on previously published protocols24–26 and consisted of 1x NEBuffer 2 (NEB, Ipswich USA, #B7002S), 30 µM dGTP (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: PCR amplification was done with NEB Q5 master mix (NEB #M0492), and 34 cycles of amplification ...
-
Synergistic amplifier reprograms biosensor behavior to facilitate detection of dioxin-like compoundsbioRxiv - Molecular Biology 2024Quote: ... and T4 DNA ligase were purchased from New England Biolabs (NEB, USA). E ...
-
bioRxiv - Molecular Biology 2024Quote: The total RNA from the HG and LG treated βTC6 cells were rRNA depleted using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB), followed by fragmentation and the cDNA library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Klenow Fragment (New England Biolabs) at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared for all samples using the NEB Next Ultra II Directional RNA Library Prep Kit (NEB, E7760S) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... NheI-HF (NEB, R3131), and KpnI-HF (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli (NEB, C3040). Inserts and fragments generated by PCR were synthesized using Q5 High Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The four PCR products were then assembled in a 1:1:1:1 ratio using HiFi assembly (NEB, E5520S) according to the manufacturer’s instructions to create the pLenti-STARR vector (pAS5018) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and NEBNext Ultra II End Prep Enzyme Mix (New England Biolabs) at 20°C for 30 minutes followed by 65°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... then 40 μL of each sample was used reactions as outlined in the manufacturer’s protocol for denaturing reaction conditions using the Protein Deglycosylation Mix II Kit (New England Biolabs, P6044) both with and without deglycosylase enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and KpnI-HF (NEB, R3142) were used according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA samples were fragmented using the NEBNext® Magnesium RNA Fragmentation Module (NEB, E6150S) at 94°C for 4 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by fragmentation and the cDNA library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... SINV-REP construct derived from pToto64 clone encoding SINV non-structural proteins and a reporter luciferase tag was linearized using SacI (New England Biolabs), followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... UDI-barcoded RNAseq libraries were generated with the NEBNext Ultra II RNA Library Prep Kit (NEB). Each library was quantified with a Qubit (dsDNA HS kit ...
-
bioRxiv - Microbiology 2024Quote: ... the purified genomic DNAs were analyzed by restriction endonuclease digestions (Bsiw I for Kp7, Age I for Kp9, and BspQ I for Kp11) (NEB Cat. R0553V, R0552V and R0712S). Each reaction contained 500 ng of the purified genomic DNA and the corresponding enzyme and was incubated for 1 hour at 55 □ for Bsiw I ...
-
bioRxiv - Microbiology 2024Quote: ... treated with DNase I (NEB), and reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... All plasmids were checked by enzymatic digestion (New England Biolabs). Plasmid DNA was extracted from 3 mL of overnight E ...
-
bioRxiv - Microbiology 2024Quote: ... Escherichia coli DH5lll bacteria (New England Biolabs), used for plasmid constructions ...
-
bioRxiv - Microbiology 2024Quote: ... 10 mM ribonucleoside-vanadyl complex (New England Biolabs, Beverley, MA, USA), and 1× complete EDTA-free protease inhibitor (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... The in situ observation of RNA digestion by RNase was executed through introducing a 0.2 U/µL of ShortCut RNase III (New England Biolabs) to the AFM liquid cell during imaging ...
-
bioRxiv - Microbiology 2024Quote: ... purified using the Monarch DNA Gel Extraction kit (NEB) and ligated using T4 DNA ligase (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... each pair of oligonucleotides was annealed and phosphorylated with T4 PNK (New England Biolabs, # M0201) following the manufacturer’s instructions ...