Labshake search
Citations for Illumina :
601 - 650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Illumina 150 Paired-End sequencing in biological replicates ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pooled libraries were sequenced using NextSeq 500 (Illumina), and single-end reads of 75 bp length were obtained ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Illumina 150 Paired-End sequencing in biological replicates ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq® Stranded RNA LT kit (Illumina, San Diego, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XP kit (Illumina) was used to prepare the sequencing library for sequencing on the HiSeq 2500 and NextSeq 1000 instruments (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... The final co-culture RNA-sequencing library (fig. S20B) was deep-sequenced on a NovaSeq 6000 instrument with a 100 cycles S2 Kit (Illumina, San Diego, CA, USA) in paired-end mode (Read 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequencing libraries were prepared with Pico Nextera kit (Illumina), as per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was sequenced as 75bp single-end reads on the NextSeq 550 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was prepared and amplified using the SmartSeq2 protocol (Illumina, USA) and sequencing libraries were prepared with Pico Nextera kit (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... All the libraries were sequenced using a Novaseq 6000 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina) for PE100 reads ...
-
bioRxiv - Neuroscience 2024Quote: ... The sequencing process was entirely controlled by data collection software provided by Illumina, and the sequencing result data was analyzed in real-time ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The FASTQ read files were generated and demultiplexed and adapters were trimmed with the bcl2fastq v2.20 Conversion Software (Illumina, San Diego, CA).
-
bioRxiv - Pathology 2024Quote: ... Samples were sent to LGC Genomics GmbH (Berlin, Germany) for DNA extraction and sequencing (150 bp paired-end reads on an Illumina NextSeq 500/550 platform). All DNA extraction ...
-
bioRxiv - Pathology 2024Quote: ... insecticola (E, F) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Pathology 2024Quote: ... Library preparation and sequencing was performed by the Genomics and Computational Biology Core (NIDCR, NIH) using an Illumina HiSeq 2500 (Illumina, San Diego, CA) configured for 37 paired-end reads (human ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subsequently sequenced on a NextSeq High (Illumina) by Novogene (Rhi and H3K9me3 ChIP-seq) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was performed on a NovaSeq 6000 instrument (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 2.5 μL Tn5 transposase (Illumina), 16.5 μL 1X PBS ...
-
Diurnal regulation of SOS Pathway and Sodium Excretion Underlying Salinity Tolerance of Vigna marinabioRxiv - Plant Biology 2024Quote: ... The prepared library was sequenced with Hiseq2000 (Illumina), which was provided as a customer service by GeneBay Inc ...
-
Diurnal regulation of SOS Pathway and Sodium Excretion Underlying Salinity Tolerance of Vigna marinabioRxiv - Plant Biology 2024Quote: ... We also obtained short-reads with Hiseq 4000 (Illumina, San Diego, USA), which was provided as a customer service by GeneBay ...
-
bioRxiv - Neuroscience 2024Quote: ... ATACseq: The ATACseq library was prepared using the Nextera DNA Library Prep Kit (Illumina) with the Active Motif proprietary method and sequenced on Illumina NextSeq 500 as 42bp paired-end reads (PE42) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was analyzed using a BioAnalyzer and samples with 8.7-10.0 RNA integrity number values were used for library preparation using the Illumina TruSeq RNA Sample Preparation v2 Guide (Illumina). Libraries were sequenced on an Illumina NextSeq 500 as 42bp paired-end reads (PE42) ...
-
bioRxiv - Plant Biology 2024Quote: ... More than 10 µg of RNA per sample was sent to Novogene (Cambridge, UK) for library preparation and massive sequencing on an Illumina Novaseq 6000 (Illumina, San Diego, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... Raw sequence data (.bcl files) generated from Illumina NovaSeq was converted into fastq files and de-multiplexed using Illumina bcl2fastq program version 2.20 ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by sequencing on a HiSeq4000 system (Illumina; San Diego, CA, USA) at the McGill and Genome Quebec Innovation Center (https://cesgq.com/en-services) ...
-
bioRxiv - Plant Biology 2024Quote: ... and sequenced using Illumina’s state-of-the-art NovaSeq 6000 V1.5 platform (Illumina, Gurgaon, India). This produced 150 base pair long paired-end reads ...
-
bioRxiv - Neuroscience 2024Quote: Approximately 500 ng of total RNA was used for cDNA library preparation with oligo-dT primers following the Illumina TruSeq preparation guide (Illumina, San Diego, CA) (Mecklenburg et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... All genotypes were resequenced (Illumina HiSeq X10 and Illumina NovaSeq 6000 paired-end sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... and sequenced using a NovaSeq S4 Reagent Kit (catalog no. 20027466, Illumina) for 200 cycles at a depth of approximately 250-400 million read-pairs per sample ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were loaded at 300 pM into a NovaSeq 6000 System (Illumina) and sequenced using a NovaSeq S4 Reagent Kit (catalog no ...
-
bioRxiv - Neuroscience 2024Quote: ... All libraries were sequenced by Novaseq6000 (Illumina, San Diego, CA, USA) on a 150 bp paired-end run.
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... S63del and S63del/Xbp1SC-KO mice using the Zymo RNA Clean & Concentrator-5 (#R1013) and sent to Genewiz (South Plainfield, NJ) for library preparation after PolyA selection and Illumina sequencing (Illumina HiSeq 2x150bp). Illumina sequencing data were mapped to the GRCm38/mm10 genome using the STAR aligner.35 Data were analyzed using DESeq2 to determine differentially regulated genes (p-value < 0,5).36 RNA-seq data are deposited in NCBI GEO under accession number GSE252089.
-
bioRxiv - Pathology 2024Quote: ... paired-end libraries were sequenced by Illumina Novaseq 6000 platform (150bp*2 ...
-
bioRxiv - Neuroscience 2024Quote: ... The libraries were then sequenced with Illumina NovaSeq 6000 (Illumina; San Diego, CA). The snRNA-seq raw sequencing files were processed with CellRanger 6.0 (10x Genomics ...
-
bioRxiv - Pathology 2024Quote: ... and 2ng of each sample was used to construct a pool of uniquely indexed samples (Illumina Cat# FC- 131-1096). A second amplification was performed with 12 cycles and cleaned up with AMPure XP beads ...
-
bioRxiv - Neuroscience 2024Quote: ... then run on a NovaSeq 6000 S1 flow cell (Illumina) to a target sequencing depth of 60 million reads per sample using NovaSeq Control Software v1.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were pooled for sequencing with a NovaSeq 6000 (Illumina) at an estimated depth of 110,000 reads per cell ...
-
bioRxiv - Pathology 2024Quote: ... The libraries were sequenced using a NovaSeq 6000 (Illumina) for both mRNA and ATAC sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... Raw sequence data (.bcl files) generated from Illumina NovaSeq was converted into fastq files and de-multiplexed using Illumina bcl2fastq program version 2.20 ...
-
bioRxiv - Neuroscience 2024Quote: Sequencing reads were first demultiplexed using the Miseq Reporter (Illumina). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina indexes were added by amplifying 1 ng DNA to a 50 μl PCR reaction using Kapa HS enzyme and unique dual indexing primers (Illumina) for 11 cycles (Denaturation 95°C 3min ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were sequenced on NextSeq High Output Flow Cell (Illumina) for 150 cycles to generate a total of 60M paired-ended ...
-
bioRxiv - Neuroscience 2024Quote: ... Ligation of sequencing indices (Nextera XT Sequencing Index Kit, Illumina) and 10 cycles of enrichment PCR were performed with Kapa HiFi polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced using an MiSeq Reagent Kit v3 (600-cycle format; Illumina Inc.) on an Illumina MiSeq sequencer (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with the P5 and P7 adapters (Illumina Inc.) necessary for Miseq sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... BCL raw data were converted to FASTQ data and demultiplexed by the bcl2fastq Conversion Software (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were resuspended in transposition mix (25 µL 2x TD buffer (Illumina), 16.5 µL PBS ...