Labshake search
Citations for Bioline :
151 - 200 of 1617 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and cDNA was synthesized (Bioline) using random hexamers as previously described (16,18,78) ...
-
bioRxiv - Microbiology 2023Quote: ... using the SensiFAST SYBR & Fluorescein Kit (Bioline), on a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... before synthesis of cDNA using random hexamers (Bioline; Edwards, Nawrocki et al. 2014). Quantitative reverse-transcription PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline). RT PCR was carried out in a Rotor-gene Q2 PLEX (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using the SensiFAST SYBR No-ROX kit (Bioline) according to the manufacturer’s protocol and the LightCycler480 Instrument II (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA synthesised using SensiFAST cDNA synthesis kit (Bioline). Reactions were performed in a QuantStudio6 pro real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Lo-ROX kit (Bioline). Melt curve analysis was performed ...
-
bioRxiv - Cancer Biology 2023Quote: ... edulis using the sensiFASTTMSyBR® No-ROX Kit (Bioline) and the LightCycler® 480 Real-Time PCR (Roche Life Science ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from cells with Isolate II RNA Mini Kit according to the manufacturer’s instructions (Bioline, BIO-52702). 1 μg of RNA was converted to cDNA using qScript (Quanta ...
-
bioRxiv - Immunology 2023Quote: ... Transcript expression was quantified using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... MyTaq™ Mix (Bioline; BIO-25041) was used ...
-
bioRxiv - Systems Biology 2023Quote: ... purified (BIO-52059; Bioline), and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L ...
-
bioRxiv - Systems Biology 2023Quote: ... Each 20 µl RT reaction was amplified in a 100µl PCR reaction with MyTaq Red mix (#BIO-25043; Bioline). The second PCR reaction was performed using 10 µl of the product of the previous reaction in a 100 µl reaction using the same index variant primer and index variants of 437JvA (containing the S1 ...
-
bioRxiv - Systems Biology 2023Quote: ... 14 PCR cycles were performed using MyTaq Red Mix (#BIO-25043; Bioline), yielding 30 µg of barcodes ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were collected 24 hours after transfection in 5 ml of TRIsure (#BIO-38032; Bioline) and frozen at -80 °C until further processing.
-
bioRxiv - Immunology 2023Quote: RT-PCR was done using the RedTaq DNA Polymerase (Bioline, Memphis, TN, USA) following the recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... the k13 and pfcrt loci was amplified directly from recrudesced infected blood using the MyTaq Blood-PCR Kit (Bioline) (68) ...
-
bioRxiv - Plant Biology 2023Quote: Measurements were carried out in 96-well plates using the SensiFAST™ SYBR® Kit (Bioline, Luckenwalde, Germany) in a LightCycler® 480 (Roche) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The different PCR polymerases and buffers were supplied by Meridian Bioscience (formerly Bioline). The oligonucleotides were supplied by Merck (formerly Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... using ISOLATE II RNA mini kit (Bioline). cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Plant Biology 2023Quote: ... using SensiMix SYBR master mix (Bioline), in duplicate for each biological replicate ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was lysed in 50 µl Trisure (Bioline, London, UK), and RNA was isolated with the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated according to manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Agarose was purchased from Bioline (Bioline AgroSciences Ltd. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Agarose was purchased from Bioline (Bioline AgroSciences Ltd. ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed using SensiMix™ SYBR® No-ROX Kit (Bioline) in a QuantStudio™ 6 Flex System (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... Hyperladder 50 bp or Hyperladder 1 kb (Bioline) served as DNA fragment size markers.
-
bioRxiv - Cell Biology 2023Quote: ... 1μg of RNA was used to synthesize cDNA with SensiFAST cDNA Synthesis Kit (Bioline) and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl of the dilution was mixed with 0.41 μM primers (Supplemental Table S4) and 1x Sensifast SYBR non-Rox kit (Bioline Bio98005). The real-time PCR program cycled as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... was synthesized using the Sensifast synthesis kit (Bioline Bio-65053, manufacturer’s protocol) then diluted 1:5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The targeted region was amplified by PCR (MyTaq Red mix, Bioline) from 100 ng of genomic DNA ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed in triplicate on 50 ng of cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) with a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified using the SensiFAST Probe No-ROX One-Step kit (Bioline, cat. BIO-76001) using primers and probe targeting the NP gene of MOPV (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted immunoprecipitation output was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Tetro cDNA Synthesis Kit (BIO-65043; BioLine) was used for transcribing mRNA into cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1kb HyperLadder (Bioline) was loaded on each gel as a reference.
-
bioRxiv - Immunology 2023Quote: ... The 2xSensiMix SYBR Lo-ROX kit (Bioline, UK) was used for quantification of Cxcl9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Genetics 2023Quote: ... RNA isolation with TriSure (Bioline) was performed following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCRs were performed using the SensiFAST SYBR NoROX Kit (Bioline) and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Genomics 2023Quote: ... Samples were prepared for qPCR in technical duplicates in 10-μl reaction volumes using SensiFAST SYBR Lo-ROX 2× Master Mix (Bioline, BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 μM and cDNA diluted at 1:20 by volume ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.5µg) was reverse transcribed using 50U Tetro reverse transcriptase (Bioline), 40mM dNTPs (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was suspended in 100 μl of preheated elution buffer G (ISOLATE II Genomic DNA kit, Bioline Meridian). The DNA quality and quantity was checked by Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthetized from 200 ng of RNA using the SensiFAST cDNA Synthesis kit (Bioline) and gene expression was analyzed by qPCR in a CFX96 Touch Real-Time PCR instrument (Bio-Rad ...