Labshake search
Citations for Bioline :
301 - 350 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription was carried out with Tetro RT enzyme (Bioline). The 20 µl RT reaction mix consisted of 2.5 µl of total RNA (at 300 ng/µl) ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the cDNA was performed using Mango Taq enzyme kit (Bioline) in 25 µl reaction mix composed of 2.5 µl of cDNA ...
-
bioRxiv - Genomics 2023Quote: ... Samples were compared to 1 Kb hype ladder (Bioline). The primer sequences are listed in Table S9.
-
bioRxiv - Immunology 2023Quote: ... SensiFAST SYBR NO-ROX (BioLine) and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005), UPL probes (Roche ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from MSNs utilizing an RNA extraction kit (Bioline, BIO-52073). RNA library preparation was prepared at the UC Davis Genomics Core or Novogene ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by its conversion into cDNA with the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65053). qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline ...
-
bioRxiv - Pathology 2023Quote: ... All real-time PCR reactions were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Pathology 2023Quote: ... Reactions for uniplex and duplex assays were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Immunology 2023Quote: ... Quantification of transcript expression was performed using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: The total RNA from cell culture and mouse tissues were extracted using the TRIsure™ (Bioline, Cat.BIO-38033) reagent according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were visualised by electrophoresis in TAE buffer on a 1.5% agarose gel (Bioline, London, UK) stained with 1x SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The primers were tested with PCR using MyTaq DNA polymerase (Bioline, London, UK), with annealing temperature of 61 °C and an extension time of 30 s ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Plant Biology 2023Quote: ... The diluted cDNA was then used as a template for quantitative Real-Time PCR following the manufacturer’s instructions (SensiFAST™ SYBR® No-ROX Kit; Bioline). Samples were amplified following the manufacturer’s instructions and fluorescence was monitored with a CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µl MyTaq™ Red Mix (Bioline, Meridian bioscience) was used with 2 µl 20 µM primer mix ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time RT-PCR was performed using a SensiFastTM SYBR® Hi-ROX kit (#BIO-92020; Bioline USA Inc.) in an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SensiFAST SYBR Lo-ROX Kit (Bioline, #BIO-94020) was utilized for the qRT-PCR ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Genetics 2023Quote: ... 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA) were used in qPCR using SYBR green containing supermix (Bioline) on the Biorad CFX96 thermal cycler (Biorad ...
-
bioRxiv - Genetics 2023Quote: ... 1 µg of RNA was used to prepare cDNA using the Sensifast cDNA synthesis kit (Bioline, London, UK). 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were purified using the ISOLATE II PCR and Gel Kit (Bioline, BIO-52060) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 1x MyTaq Red Reaction buffer red and 0.5 μl of MyTaq DNA polymerase (Bioline) on SimpliAmp thermal cycler (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... The 2xSensiMix SYBR Lo-ROX kit (Bioline, UK) was used for quantification of Cxcl9 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.5µg) was reverse transcribed using 50U Tetro reverse transcriptase (Bioline), 40mM dNTPs (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was suspended in 100 μl of preheated elution buffer G (ISOLATE II Genomic DNA kit, Bioline Meridian). The DNA quality and quantity was checked by Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Hellas) or AppliChem (Bioline Scientific SA, Hellas). Glucose 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using the SensiFAST SYBR No-ROX kit (Bioline) according to the manufacturer’s protocol and the LightCycler480 Instrument II (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was isolated using the ISOLATE II Genomic DNA Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA synthesised using SensiFAST cDNA synthesis kit (Bioline). Reactions were performed in a QuantStudio6 pro real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Lo-ROX kit (Bioline). Melt curve analysis was performed ...
-
bioRxiv - Microbiology 2023Quote: ... in 20μl reactions using the Sensi FAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR) analysis using SensiFAST SYBR Lo-ROX Kit (Bioline). Samples were analyzed using a QuantStudio 3 Real-Time PCR System (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from lung homogenates from mice exposed to E-cigarettes (with and without nicotine) and room air (SHAM) using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Plant Biology 2023Quote: Further RNA purification was performed using the Isolate II RNA Plant Kit (Bioline). Washing ...
-
bioRxiv - Pathology 2023Quote: ... using SensiFAST SYBR NO ROX kit (Bioline). Fluorescent dye intensity was analyzed and quantified with linear regression ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of the entry vector was also digested with EcoRI-HF and NheI-HF and the linearised product was purified from a 2% agarose gel using PCR Isolate II PCR and Gel Kit (Bioline). The digested and purified reporter pool was then ligated into 80 ng of the linearised entry vector using Takara ligation kit v1.0 (#6021 ...
-
bioRxiv - Genetics 2023Quote: PCR validations were performed using MyTaq DNA polymerase (Bioline), including 20 pmol of each primer (Additional file 6) ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCRs were performed using the SensiFAST SYBR NoROX Kit (Bioline) and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Genetics 2023Quote: ... RNA isolation with TriSure (Bioline) was performed following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Agarose was purchased from Bioline (Bioline AgroSciences Ltd. ...