Labshake search
Citations for Bioline :
301 - 350 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Proteinase K was from Bioline. Amicon filters were from Merck-Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... and a sample was taken for DNA extraction and purification using an Isolate II Genomic DNA purification kit (Bioline). Also ...
-
bioRxiv - Genetics 2023Quote: ... About 400ng total RNA was used in SensiFast cDNA synthesis kit (Bioline, BIO-65053). The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were plated at 1M/mL and harvested in TRIsure (Bioline #38033). RNA was extracted using Direct-zol RNA MicroPrep columns (Zymo #R2062 ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions (10 μL total volume) contained 5 μL of 2 × SensiFAST™ SYBR No-ROX Kit (Bioline, London, UK), 0.2 μM of each arsM gene primer ...
-
bioRxiv - Biochemistry 2023Quote: ... using TaqMan™ Gene Expression Assays (FAM-labelled) and the SensiFASTTM Probe Hi-ROX kit (Bioline). The following TaqMan™ Gene Expression Assays were used ...
-
bioRxiv - Developmental Biology 2023Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and SYBR Green Master Mix (Bioline). The relative expressions were calculated using the 2(−ΔΔCT ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: We obtained the bees from a commercial supplier (Syngenta Bioline, Weert, The Netherlands). We then tagged them with Opalith number tags (Christian Graze KG ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline) on a CFX96 qPCR machine (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... and a quantitative PCR was performed using SensiFast SYBR (Bioline, 98020) and Bio-Rad CFX Connect thermocycler ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using 1U MyTaq HS DNA Polymerase (BioLine) in 1× MyTaq buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine, BIO-72001). Samples were run in triplicate for each primer set.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA for genome sequencing was isolated using the ISOLATE II Genomic DNA Kit (Bioline). For identification of DNA alterations in strain K18 ...
-
bioRxiv - Microbiology 2023Quote: ... A fragment of each gene was individually amplified by polymerase chain reaction (PCR) from the leaf DNA extracts using the MyTaq reaction buffer and polymerase (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from cells using the ISOLATE II RNA Mini Kit (Bioline) and concentration was measured by Nanodrop (Thermo Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Tissue homogenates were prepared in RNA lysis buffer RLY1 (Bioline) from a 15 mg slice of tissue using a tissue homogenizer ...
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription was carried out with Tetro RT enzyme (Bioline). The 20 µl RT reaction mix consisted of 2.5 µl of total RNA (at 300 ng/µl) ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the cDNA was performed using Mango Taq enzyme kit (Bioline) in 25 µl reaction mix composed of 2.5 µl of cDNA ...
-
bioRxiv - Genomics 2023Quote: ... Samples were compared to 1 Kb hype ladder (Bioline). The primer sequences are listed in Table S9.
-
bioRxiv - Immunology 2023Quote: ... SensiFAST SYBR NO-ROX (BioLine) and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005), UPL probes (Roche ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from MSNs utilizing an RNA extraction kit (Bioline, BIO-52073). RNA library preparation was prepared at the UC Davis Genomics Core or Novogene ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by its conversion into cDNA with the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65053). qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline ...
-
bioRxiv - Pathology 2023Quote: ... All real-time PCR reactions were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Pathology 2023Quote: ... Reactions for uniplex and duplex assays were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Immunology 2023Quote: ... Quantification of transcript expression was performed using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: The total RNA from cell culture and mouse tissues were extracted using the TRIsure™ (Bioline, Cat.BIO-38033) reagent according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were visualised by electrophoresis in TAE buffer on a 1.5% agarose gel (Bioline, London, UK) stained with 1x SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The primers were tested with PCR using MyTaq DNA polymerase (Bioline, London, UK), with annealing temperature of 61 °C and an extension time of 30 s ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Plant Biology 2023Quote: ... The diluted cDNA was then used as a template for quantitative Real-Time PCR following the manufacturer’s instructions (SensiFAST™ SYBR® No-ROX Kit; Bioline). Samples were amplified following the manufacturer’s instructions and fluorescence was monitored with a CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µl MyTaq™ Red Mix (Bioline, Meridian bioscience) was used with 2 µl 20 µM primer mix ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time RT-PCR was performed using a SensiFastTM SYBR® Hi-ROX kit (#BIO-92020; Bioline USA Inc.) in an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... were used for complementary DNA synthesis and SensiFAST SYBR kit reagents (Bioline) were used for Q-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were subsequently separated using 1% agarose gels prepared with molecular grade agarose (Bioline, BIO-41025), Tris base-acetic acid-EDTA (TAE ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ranger (Bioline, #BIO21121) or Q5 (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) or Phusion (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and HyperlLadder 1 kb (Bioline) was used for size determination.
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and quantitative real-time PCRs (qRT-PCR) were performed using the SensiFast SYBR No-ROX One Step kit (Bioline) in a Rotor-Gene Q lightcycler (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted using the NucleoSpin RNA XS kit (Machery-Nagel) and cDNA was generated using the SensiFast cDNA synthesis kit (BioLine). Quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse-transcribed (1 mg each experimental point) by using SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed as described (18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and qPCR was performed as described (18) using SensiFast Sybr Lo-Rox Mix (BIO-94020, Bioline). The run was performed by using the Applied Biosystems (Waltham ...
-
bioRxiv - Microbiology 2023Quote: PCR products for the generation of different potential RNase E targets were amplified with MyTaq™ Red Mix 2x (Bioline), and Synechocystis genomic DNA as template (primers T01 to T12) ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 1:100 10 mg/mL Proteinase K (Bioline). TIDE was performed as described before (40) ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...