Labshake search
Citations for Bioline :
351 - 400 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Agarose was purchased from Bioline (Bioline AgroSciences Ltd. ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed using SensiMix™ SYBR® No-ROX Kit (Bioline) in a QuantStudio™ 6 Flex System (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl of the dilution was mixed with 0.41 μM primers (Supplemental Table S4) and 1x Sensifast SYBR non-Rox kit (Bioline Bio98005). The real-time PCR program cycled as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... was synthesized using the Sensifast synthesis kit (Bioline Bio-65053, manufacturer’s protocol) then diluted 1:5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The targeted region was amplified by PCR (MyTaq Red mix, Bioline) from 100 ng of genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 1μg of RNA was used to synthesize cDNA with SensiFAST cDNA Synthesis Kit (Bioline) and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µl of 2X Mix SensiFast Sybr NO-ROX Kit (Bioline), and 2.8µl of sterile molecular biology grade water (Hyclone Hypure ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted immunoprecipitation output was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Tetro cDNA Synthesis Kit (BIO-65043; BioLine) was used for transcribing mRNA into cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1kb HyperLadder (Bioline) was loaded on each gel as a reference.
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthetized from 200 ng of RNA using the SensiFAST cDNA Synthesis kit (Bioline) and gene expression was analyzed by qPCR in a CFX96 Touch Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified using the SensiFAST Probe No-ROX One-Step kit (Bioline, cat. BIO-76001) using primers and probe targeting the NP gene of MOPV (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed in triplicate on 50 ng of cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) with a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... using the SensiFAST SYBR Hi-ROX kit (Bioline). Predesigned KiCqStart SYBR green primers for the analyzed cytokines ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline). RT PCR was carried out in a Rotor-gene Q2 PLEX (QIAGEN) ...
-
bioRxiv - Plant Biology 2023Quote: Measurements were carried out in 96-well plates using the SensiFAST™ SYBR® Kit (Bioline, Luckenwalde, Germany) in a LightCycler® 480 (Roche) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The different PCR polymerases and buffers were supplied by Meridian Bioscience (formerly Bioline). The oligonucleotides were supplied by Merck (formerly Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MyTaq™ Mix (Bioline; BIO-25041) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... using ISOLATE II RNA mini kit (Bioline). cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Plant Biology 2023Quote: ... using SensiMix SYBR master mix (Bioline), in duplicate for each biological replicate ...
-
bioRxiv - Immunology 2023Quote: RT-PCR was done using the RedTaq DNA Polymerase (Bioline, Memphis, TN, USA) following the recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... the k13 and pfcrt loci was amplified directly from recrudesced infected blood using the MyTaq Blood-PCR Kit (Bioline) (68) ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was lysed in 50 µl Trisure (Bioline, London, UK), and RNA was isolated with the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated according to manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was performed with the SensiFAST SYBR No-Rox kit (Bioline, BIO-98005) and μM of each primer ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 1:100 10 mg/mL Proteinase K (Bioline). TIDE was performed as described before (40) ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Genomics 2023Quote: ... supplied with 1:100 10 mg/mL Proteinase K (Bioline, cat. no. BIO-37084). The cells were lysed by incubating for 3h at 55°C and the Proteinase K was inactivated for 10 min at 95°C ...
-
bioRxiv - Genomics 2023Quote: ... The samples were collected 72 hours after the addition of the drugs and genomic DNA (gDNA) was extracted using the ISOLATE II genomic DNA kit (Bioline, BIO-52067). The samples were then quantified using Nanodrop and 200 ng of gDNA was used in the library PCRs that were performed as for the screening above ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified in 10 μL reactions containing 2x SensiMix (Bioline) and 1 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from the cells using TRIsure (Bioline) following the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR® No-ROX Kit (Bioline, BIO-98020) in the Magnetic Induction Cycler (MIC ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Molecular weight markers used were the 1 kb HyperLadder (from Bioline). T4 DNA ligase and buffer were purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... edulis using the sensiFASTTMSyBR® No-ROX Kit (Bioline) and the LightCycler® 480 Real-Time PCR (Roche Life Science ...
-
bioRxiv - Immunology 2023Quote: ... Transcript expression was quantified using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Developmental Biology 2023Quote: ... and suspended in TRIsure (Bioline). 30 embryos were used for 80epi stage ...
-
bioRxiv - Cell Biology 2023Quote: ... zona-less E2.5 and E3.5 embryos were placed into 10 µL of DNA lysis buffer (1X MyTaq Red Mix, Bioline, #25044) complemented with 0.2 µL of 10 mg/mL proteinase K (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... the embryos were individually scraped off the microscope slide using drawn-out glass pipettes (new pipette for each embryo) filled with 1X MyTaq Red mix (Bioline, #25044), aspirated and transferred into 10 µL of DNA lysis buffer and processed for genotyping as described above.
-
bioRxiv - Microbiology 2023Quote: ... The total RNA was extracted with an Isolate II RNA minikit (Bioline) and analyzed by qRT-PCR with specific primers for ZTA ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 2X Mango Mix (Bioline 25034) and 16 μL of PCR grade water ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from cells with Isolate II RNA Mini Kit according to the manufacturer’s instructions (Bioline, BIO-52702). 1 μg of RNA was converted to cDNA using qScript (Quanta ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed on cDNA samples using SensiFAST™ SYBR® Hi-ROX or SensiFAST™ Probe No-ROX kits (Bioline) on a StepOnePlus real-time PCR apparatus (Applied Biosystems) ...