Labshake search
Citations for Bioline :
451 - 500 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... or Isolate II RNA mini kit (Bioline). DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was isolated using the Isolate II Genomic DNA kit (Bioline). Library preparation and whole genome sequencing was performed at the Hartwig Medical Foundation using the HiSeqX system generating 2 × 150 base read pairs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR assays were carried out in the 7500 Real Time PCR System from Applied Biosystems using SensiFAST SYBR Lo-ROX Kit (BioLine, London, UK) and primers previously described [7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was made from purified total RNA using SensiFAST™ cDNA Synthesis Kit (#BIO-65053, Bioline) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The qPCR was conducted using SensiFAST™ SYBR® Lo-ROX kit (Bioline) on the AB7300 machine and analyzed using the 7300 system sds Software (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR was performed with 20 µl Mango Mix™ (Bioline, UK), 0.25 µM of each primer and 2 µl of DNA template in a final volume of 40 µl with nuclease free water (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: ... Routine PCR genotyping of was performed using MyTaq Red mix (Bioline) and using the mentioned primers in 2:1:1 combination ...
-
bioRxiv - Molecular Biology 2023Quote: ... and SYBR green chemistry (Bioline, London, UK), were conducted to confirm and validate template cDNA quality ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were re-evaluated for specificity and to ensure that they produced only a single band of the appropriate length using MyTaq DNA Polymerase (Bioline, Alexandria, NSW, Australia) and agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2023Quote: ... Tetro cDNA synthesis kit (BIOLINE, Cat# BIO-65043) was employed to synthesis cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed with the Bio-Rad CFX96 cycler using the SensiFAST™ SYBR® (Bioline). Gene expression for occludin (Ocln) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was isolated using TRIsure (Bioline, Cat. No. BIO-38032) following standard phenol-chloroform RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... 7.5 μL of 2x MyTaq HS Mix polymerase (Bioline), 0.45 μL of 10 μM forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... both samples were subjected to PCR with human GAPDH-specific primers41 and MyTaq polymerase (Bioline, Taunton, MA). Resulting PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline, BIO-98005) in a Light Cycler 480 II system (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 400 ng of total RNA was retrotranscribed to cDNA using SensiFASTTM cDNA Synthesis Kit (Bioline), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and SYBR Green Master Mix (Bioline). The relative expressions were calculated using the 2(−ΔΔCT ...
-
bioRxiv - Developmental Biology 2023Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer instructions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: We obtained the bees from a commercial supplier (Syngenta Bioline, Weert, The Netherlands). We then tagged them with Opalith number tags (Christian Graze KG ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplicon PCR was conducted using 50ng of DNA (or 20ng for samples with lower DNA yield) along with 2x Accuzyme mix (Bioline) to amplify barcodes using the following primer sequences (Forward - ACTGACTGCAGTCTGAGTCTGACAG ...
-
bioRxiv - Cell Biology 2023Quote: ... and qPCR performed using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline). The qPCR reaction was performed in triplicate for each sample on QuantStudioTM 5 Real-Time PCR system with SensiFAST™ SYBR® Lo-ROX kit-compatible cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... using 2x SensiFAST SYBR Lo-ROX Mix (Bioline, cat #BIO-94002) following manufacturers’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Increasing amounts of poly(dT) (average length 221bp) (Bioline) or additional unlabeled ATP (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using SensiFAST™ SYBR® Lo-ROX Kit (Bioline) and either the QuantStudio™ 5 or QuantStudio™ Flex 7 analyser (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... Roots were mounted in water under a pad of 0.8% agarose (Bioline). Imaging was performed using a CSU-W1 spinning disk head (Yokogawa ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resultant bands were compared to a 1 Kb HyperLadder (Bioline) using the expected sizes per gene region as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was prepared for RT-qPCR using the SensiFAST cDNA preparation kit according to manufacturer instructions (Bioline #65054). 1µL of cDNA was used per RT-qPCR reaction prepared with SYBR Lo-ROX (Bioline #94020) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1µL of cDNA was used per RT-qPCR reaction prepared with SYBR Lo-ROX (Bioline #94020). cFos primers were from9 ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite PCR reactions used MyTaq HS DNA polymerase (Bioline), and contained 1× reaction buffer ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were prepared using the MyTaq DNA polymerase kit (Bioline, Cat# BIO-21111). Reactions contained a 5× MyTaq Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 ml chloroform was added for phase separation using phase lock gel heavy tubes and RNA isolation from the aqueous phase was obtained by using ISOLATE II RNA Mini Kit (Bioline). RNA quality was verified with Agilent 2100 Bioanalyzer System using RNA Nano Chips (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... Proteinase K was from Bioline. Amicon filters were from Merck-Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... and a sample was taken for DNA extraction and purification using an Isolate II Genomic DNA purification kit (Bioline). Also ...
-
bioRxiv - Genomics 2023Quote: ... final libraries were quantified by qPCR comparison to previously-sequenced NGS libraries using Illumina P5/P7 qPCR primers and SensiMix SYBR (Bioline).
-
bioRxiv - Genomics 2023Quote: Genomic DNA was extracted using either the Bioline Isolate II Genomic DNA Kit (Bioline, Eveleigh, Australia) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... 50 ng of random hexamers (Bioline), and 1 μg of total RNA (in a total volume of 11 μl) ...
-
Mapping chromatin state and transcriptional response in CIC-DUX4 undifferentiated round cell sarcomabioRxiv - Cancer Biology 2023Quote: ... Total RNA (1000 ng) was used in a reverse transcriptase reaction with the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative PCR included 3 replicates per cDNA sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ISOLATE II RNA Mini Kit (Bioline) was used to extract RNA from CRC patient samples following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline) on a CFX96 qPCR machine (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and a 1 kbp HyperLadder (Bioline). Genomic DNA extraction from new tissue samples was conducted using the MagJet gDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... SensiFAST SYBR NO-ROX (BioLine) and specific primers for ...
-
bioRxiv - Genomics 2023Quote: ... or TRIsure (Bioline, London, UK) using the Ultra-Turrax T10 (IKA Labortechnik ...
-
bioRxiv - Immunology 2023Quote: ... and a quantitative PCR was performed using SensiFast SYBR (Bioline, 98020) and Bio-Rad CFX Connect thermocycler ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were plated at 1M/mL and harvested in TRIsure (Bioline #38033). RNA was extracted using Direct-zol RNA MicroPrep columns (Zymo #R2062 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using Sensifast cDNA synthesis kit (Bioline, BIO-65054). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine, BIO-72001). Samples were run in triplicate for each primer set.