Labshake search
Citations for Bioline :
101 - 150 of 1617 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Amplification of the cDNA was performed using Mango Taq enzyme kit (Bioline) in 25 µl reaction mix composed of 2.5 µl of cDNA ...
-
bioRxiv - Genomics 2023Quote: ... Samples were compared to 1 Kb hype ladder (Bioline). The primer sequences are listed in Table S9.
-
bioRxiv - Immunology 2023Quote: ... SensiFAST SYBR NO-ROX (BioLine) and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005), UPL probes (Roche ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from MSNs utilizing an RNA extraction kit (Bioline, BIO-52073). RNA library preparation was prepared at the UC Davis Genomics Core or Novogene ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by its conversion into cDNA with the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65053). qPCR was conducted using the SensiFAST Probe No-ROX Kit (Bioline ...
-
bioRxiv - Pathology 2023Quote: ... All real-time PCR reactions were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Pathology 2023Quote: ... Reactions for uniplex and duplex assays were performed in 20 μL volumes containing 10 μL Immomix (Bioline) and 5 μL of DNA template ...
-
bioRxiv - Immunology 2023Quote: ... Quantification of transcript expression was performed using Sybr green reaction mix SensiFAST (Bioline, #BIO-86005) and 10 pmol of specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: The total RNA from cell culture and mouse tissues were extracted using the TRIsure™ (Bioline, Cat.BIO-38033) reagent according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were visualised by electrophoresis in TAE buffer on a 1.5% agarose gel (Bioline, London, UK) stained with 1x SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products visualized by electrophoresis on 2% agarose (Bioline, London, UK) gel stained with SYBR Safe (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The primers were tested with PCR using MyTaq DNA polymerase (Bioline, London, UK), with annealing temperature of 61 °C and an extension time of 30 s ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Plant Biology 2023Quote: ... The diluted cDNA was then used as a template for quantitative Real-Time PCR following the manufacturer’s instructions (SensiFAST™ SYBR® No-ROX Kit; Bioline). Samples were amplified following the manufacturer’s instructions and fluorescence was monitored with a CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µl MyTaq™ Red Mix (Bioline, Meridian bioscience) was used with 2 µl 20 µM primer mix ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time RT-PCR was performed using a SensiFastTM SYBR® Hi-ROX kit (#BIO-92020; Bioline USA Inc.) in an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... This cDNA library was then PCR barcoded with PCR Primer 1.0 (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3’) and a sample-specific barcode primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTG-3’) using MyTaq Red Mix (Bioline) for 15 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... were used for complementary DNA synthesis and SensiFAST SYBR kit reagents (Bioline) were used for Q-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25uM forward and reverse oligo primers (see supplementary table 6) and SensiFAST SYBR Hi-ROX Kit (Bioline, BIO-92005) in 384-well plates with the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were subsequently separated using 1% agarose gels prepared with molecular grade agarose (Bioline, BIO-41025), Tris base-acetic acid-EDTA (TAE ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ranger (Bioline, #BIO21121) or Q5 (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) or Phusion (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and HyperlLadder 1 kb (Bioline) was used for size determination.
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and quantitative real-time PCRs (qRT-PCR) were performed using the SensiFast SYBR No-ROX One Step kit (Bioline) in a Rotor-Gene Q lightcycler (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted using the NucleoSpin RNA XS kit (Machery-Nagel) and cDNA was generated using the SensiFast cDNA synthesis kit (BioLine). Quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse-transcribed (1 mg each experimental point) by using SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed as described (18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and qPCR was performed as described (18) using SensiFast Sybr Lo-Rox Mix (BIO-94020, Bioline). The run was performed by using the Applied Biosystems (Waltham ...
-
bioRxiv - Microbiology 2023Quote: PCR products for the generation of different potential RNase E targets were amplified with MyTaq™ Red Mix 2x (Bioline), and Synechocystis genomic DNA as template (primers T01 to T12) ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 1:100 10 mg/mL Proteinase K (Bioline). TIDE was performed as described before (40) ...
-
bioRxiv - Genomics 2023Quote: ... PCR2 was performed using 15 μL 2 x MyTaq Red Mix (Bioline, cat. no. BIO-25044) and 5 μL of each PCR1 product with well-specific Illumina PCR indexed primers (TAC0159 & TAC0009 ...
-
bioRxiv - Genomics 2023Quote: ... supplied with 1:100 10 mg/mL Proteinase K (Bioline, cat. no. BIO-37084). The cells were lysed by incubating for 3h at 55°C and the Proteinase K was inactivated for 10 min at 95°C ...
-
bioRxiv - Genomics 2023Quote: ... The samples were collected 72 hours after the addition of the drugs and genomic DNA (gDNA) was extracted using the ISOLATE II genomic DNA kit (Bioline, BIO-52067). The samples were then quantified using Nanodrop and 200 ng of gDNA was used in the library PCRs that were performed as for the screening above ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified in 10 μL reactions containing 2x SensiMix (Bioline) and 1 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4.2 µL purified DNA from chromatin immunoprecipitation was mixed with 5 µL 2x SensiFAST SYBR No-ROX kit (Bioline) and 0.4 µL forward and reverse primer (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from the cells using TRIsure (Bioline) following the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR® No-ROX Kit (Bioline, BIO-98020) in the Magnetic Induction Cycler (MIC ...
-
bioRxiv - Genomics 2023Quote: ... 25 μL 2 x MyTaq HS Red Mix (Bioline, cat. no. BIO-25048), and plate-specific Illumina PCR indexed primers (TAC0012 and TAC0007 ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was performed with the SensiFAST SYBR No-Rox kit (Bioline, BIO-98005) and μM of each primer ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
bioRxiv - Microbiology 2023Quote: ... in 20μl reactions using the Sensi FAST Probe Hi-ROX Kit (Bioline) (cycling conditions ...
-
bioRxiv - Genetics 2023Quote: ... An 800–base pair region surrounding the target site of the Cypor sgRNA was amplified (forward primer 5′-GTTTGCGGGTGTTAGCTCTTC-3′; reverse primer 5′-TTGGTGGGTAAATCACACCGT-3′) using MyTaq Red Mix (Bioline). The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2023Quote: ... PCR products purified with Isolate II PCR and Gel Kit (BIOLINE) and cloned into the entry vector pCR®8/GW/TOPO (#250020 Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 target sites within the AAVS1 locus were PCR amplified in a 25 or 50 μL reaction volume per sample using high-performance RANGER PCR Mix (Bioline USA, Inc., Memphis, TN, USA) or PlatinumTM SuperFiTM PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed using the SensiFAST SYBR Lo-ROX Kit (BIO-94020, Bioline). Primers are shown in Supplementary Table 1 ...
-
bioRxiv - Genomics 2023Quote: ... 1’ 72°C) by MyTaq Red mix (Bioline) using primers that add overhangs with EcoRI (MT024 ...
-
bioRxiv - Genomics 2023Quote: ... cells were harvested and resuspended in 800 μl TRIsure (#BIO-38032; Bioline) and stored at -80 °C until further use ...
-
bioRxiv - Microbiology 2023Quote: ... 300 ng of RNA was used to generate cDNA with SensiFAST synthesis reagents (Bioline). Quantitative PCR was performed with Fast SYBR green (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative reverse-transcription PCR (qRT-PCR) with was performed with three technical replicates using 50 ng cDNA and the SensiFAST SYBR & Fluorescein Kit (Bioline) on a Roche Lightcycler 96 instrument ...