Labshake search
Citations for Bioline :
401 - 450 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted immunoprecipitation output was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Tetro cDNA Synthesis Kit (BIO-65043; BioLine) was used for transcribing mRNA into cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1kb HyperLadder (Bioline) was loaded on each gel as a reference.
-
bioRxiv - Immunology 2023Quote: ... The 2xSensiMix SYBR Lo-ROX kit (Bioline, UK) was used for quantification of Cxcl9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A typical qPCR reaction contained 5 μl 2×SensiFAST SYBR No-Rox mix (Bioline #BIO-98080), 2∼10 ng DNA template ...
-
bioRxiv - Genetics 2023Quote: ... RNA isolation with TriSure (Bioline) was performed following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCRs were performed using the SensiFAST SYBR NoROX Kit (Bioline) and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.5µg) was reverse transcribed using 50U Tetro reverse transcriptase (Bioline), 40mM dNTPs (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was suspended in 100 μl of preheated elution buffer G (ISOLATE II Genomic DNA kit, Bioline Meridian). The DNA quality and quantity was checked by Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthetized from 200 ng of RNA using the SensiFAST cDNA Synthesis kit (Bioline) and gene expression was analyzed by qPCR in a CFX96 Touch Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... 1x MyTaq Red Reaction buffer red and 0.5 μl of MyTaq DNA polymerase (Bioline) on SimpliAmp thermal cycler (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... using the SensiFAST SYBR Hi-ROX kit (Bioline). Predesigned KiCqStart SYBR green primers for the analyzed cytokines ...
-
bioRxiv - Immunology 2023Quote: ... the aqueous phase was mixed 1:1 v/v with 70% ethanol and loaded into a column of the Isolate II RNA Mini kit (Bioline, Cincinnati, OH). Total RNA was purified following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µl of 2X Mix SensiFast Sybr NO-ROX Kit (Bioline), and 2.8µl of sterile molecular biology grade water (Hyclone Hypure ...
-
bioRxiv - Cell Biology 2023Quote: ... zona-less E2.5 and E3.5 embryos were placed into 10 µL of DNA lysis buffer (1X MyTaq Red Mix, Bioline, #25044) complemented with 0.2 µL of 10 mg/mL proteinase K (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... the embryos were individually scraped off the microscope slide using drawn-out glass pipettes (new pipette for each embryo) filled with 1X MyTaq Red mix (Bioline, #25044), aspirated and transferred into 10 µL of DNA lysis buffer and processed for genotyping as described above.
-
bioRxiv - Microbiology 2023Quote: ... The total RNA was extracted with an Isolate II RNA minikit (Bioline) and analyzed by qRT-PCR with specific primers for ZTA ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 2X Mango Mix (Bioline 25034) and 16 μL of PCR grade water ...
-
bioRxiv - Genomics 2023Quote: ... PCR products were purified using the ISOLATE II PCR and Gel Kit (Bioline, BIO-52060) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at 37°C and proteinase K (40 ug, Bioline BIO-37084) for 2 hours at 55°C ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed on cDNA samples using SensiFAST™ SYBR® Hi-ROX or SensiFAST™ Probe No-ROX kits (Bioline) on a StepOnePlus real-time PCR apparatus (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and suspended in TRIsure (Bioline). 30 embryos were used for 80epi stage ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Molecular weight markers used were the 1 kb HyperLadder (from Bioline). T4 DNA ligase and buffer were purchased from New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... SYBR Green Master mix (Bioline BIO-94020) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... and used as a template for quantitative polymerase chain reaction with reverse transcription (qRT–PCR) analysis using SensiFAST SYBR Lo-ROX Kit (Bioline). Samples were analyzed using a QuantStudio 3 Real-Time PCR System (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... primers at a final concentration of 300nM and 6μL of SensiFAST™ SYBR lo-ROX (Bioline). Telomere ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.4μL of cDNA sample was amplified by using the SensiFast Syber (Bioline) in an CFX Opus 96 Real-Time PCR Instrument (Bio-Rad Laboratories GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... 1μg of RNA was used in a 20-μl reaction mixture by using a SensiFast cDNA synthesis kit (Bioline). For real-time PCR analysis ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... primers at a final concentration of 800nM and 6μL of SensiFAST™ SYBR® Lo-ROX Kit (Bioline). qPCR conditions were ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using 2x SensiFAST SYBR No-ROX kit (Bioline) in 20 µl reactions using 1µl of RT reaction as input and 0.4µM each primer.
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR was carried out with a SensiFAST SYBR No-Rox Kit (Bioline) on a CFX96 Real-time PCR Detection System ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated RNA (0.5-1 µg) was then used for reverse transcription into first strand cDNA via a SensiFast cDNA synthesis kit (Bioline). RNA spike I (TATAA ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was reverse transcribed to cDNA using the SensiFastTM cDNA synthesis kit (Bioline, GmbH, Luckenwalde, Germany). The primers for qRT-PCR were designed using the NCBI tool Primer-BLAST–NCBI–NIH software ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from PCa cells using the Isolate II RNA Mini Kit (Bioline, London, UK) and was reverse transcribed to cDNA using the SensiFastTM cDNA synthesis kit (Bioline ...
-
bioRxiv - Cancer Biology 2023Quote: The isolation of total RNA and its conversion to cDNA were performed using the ISOLATE II RNA Mini Kit (Bioline, BIO-52073) and the qScript cDNA synthesis kit (Quanta Bioscience ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized by reverse transcribing 500ng of RNA into cDNA using the SensiFAST™ cDNA Synthesis Kit (Bioline, Meridian Life Science© Company). Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline, Meridian Life Science© Company) and a LightCycler® 480 Detection system (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: For each reaction 1μL of gDNA solution was suspended in a PCR tube with 2μL of MyTaq red reaction buffer (5x; Bioline), 1µL of pooled primers/oligonucleotides (final concentration of each primer 10μM or 5μM for Ubc-Cre) ...
-
bioRxiv - Immunology 2023Quote: ... and on-column DNase treatment and purification were performed using the ISOLATE II RNA mini kit (Bioline) or RNeasy Mini kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... 10X PCR buffer from BIOTAQ™ DNA Polymerase (Bioline, Cat. No. BIO-21040) was diluted to 1X and supplemented with proteinase K (Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... and reverse transcription was conducted using the SensiFAST kit (Bioline, BIO-65054). qPCR was conducted using the StepOne Plus system (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... with SensiFAST SYBR w/ HiRox (Bioline, BIO-92005). Following RT_qPCR and gel electrophoresis ...
-
bioRxiv - Genetics 2023Quote: ... followed by DNase I digest (Bioline) and clean up (Zymo clean and concentrate kit) ...
-
bioRxiv - Genetics 2023Quote: ... Complementary DNA (cDNA) was synthesized using Tetro cDNA synthesis kit (Bioline). Real-time PCR was done in duplicate with Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 600 ng of isolated RNA was reverse transcribed to complementary DNA (cDNA) with SensiFAST cDNA Synthesis -kit (Bioline) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... which is GC-rich and required MyTaq (Bioline #BIO-21105). The amplification ran for 30 cycles (Fig S1A ...
-
bioRxiv - Developmental Biology 2023Quote: ... BioMix Red (Bioline #BIO-25006) was used for all reactions except that which amplified C-term-4 ...