Labshake search
Citations for Bioline :
401 - 450 of 1617 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were purified with the BIOLINE ISOLATE II Plasmid Mini Kit (#BIO-52057; Bioline). Before addition to the one-pot restriction-ligation reaction ...
-
bioRxiv - Microbiology 2022Quote: ... 12.5 μl of MyTaq Red Mix (Bioline) and 0.5 μl of 10 μM of each primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified RNA (500 ng) was transcribed into cDNA with Tetro cDNA Synthesis Kit (Bioline Reagents Limited, London, UK) to analyze genes expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time quantitative PCR (RT-qPCR) reactions were performed (Bioline #BIO-98020). NCBI primer BLAST software was used for oligonucleotide design (Ye et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized with the SensiFAST cDNA Synthesis Kit (Bioline; Cat. No. 65054). Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline; Cat. No. BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 µM ...
-
bioRxiv - Molecular Biology 2022Quote: Cells or frozen tissue samples were homogenised and lysed in TRIsure (Bioline). Total RNA was isolated using EconoSpin All-In-One Mini Spin Columns (EconoSpin 1920-250 ...
-
bioRxiv - Developmental Biology 2022Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... One microlitre of Chelex extracted DNA was amplified with the appropriate primers and MyTaq polymerase (Bioline) in a 20 μl volume ...
-
bioRxiv - Neuroscience 2022Quote: ... Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054) or the iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... qPCR reactions comprised 1X SYBR Green No-Rox (Bioline), 250 nM forward and reverse primers (Supplementary Table 1) ...
-
bioRxiv - Genetics 2022Quote: ... 1X SYBR Green (Bioline), 250 nM primers up to a final volume of 10 μL were cycled using a ViiA7 real-time thermocycler and QuantStudio V1.3 (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... the SensiFAST SYBR No-ROX Kit (Bioline, BIO-98005) was used with primers for Plp1 (Forward ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from samples using the ISOLATE II RNA Micro Kit (Bioline, BIO-52075) or the ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and TaqMan probes for Gapdh (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... The purified DNAs were amplified with SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) by real-time qPCR.
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined with a quantitative real time PCR SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) on a Light Cycler® 480 Instrument II (Roche Life Sciences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and maintained with Ribosafe RNAse Inhibitor (Bioline). Quality and quantity of RNA were assessed by Nanodrop (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 μL of SensiFAST SYBR No-ROX Mix (Bioline), and 1 μL of cDNA template ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Bioengineering 2022Quote: ... E-gene expression was determined using the SensiFAST Probe No-Rox One Step Kit (Bioline) and the following primers/probes ...
-
bioRxiv - Immunology 2022Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed by using MyTaq HS Mix (BioLine) contain SYBR Green on a Mastercycler®ep Realplex PCR thermal cycler machine (Eppendorf) ...
-
bioRxiv - Molecular Biology 2022Quote: ... SYBR Green qPCR was performed by using MyTaq HS Mix (BioLine). CT values were calculated from technical duplicates ...
-
bioRxiv - Molecular Biology 2022Quote: RT-qPCR was performed in 20.0 µl final reaction volume containing 10.0 µl of 2X SensiMix SYBR® No-ROX master mix (Bioline, UK), 0.3 µM of forward and reverse primers and 1.0 µl of cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... then resuspended using the vortex in 4 mL of Trisure (Bioline Iberia, Spain) and the lysis was performed after incubation for 5 min at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR reaction was operated by using the SensiMix SYBR® from Bioline (www.bioline.com) and a Magnetic Induction Cycler (Bio Molecular Systems ...
-
bioRxiv - Neuroscience 2022Quote: ... real-time PCR cycler with SensiFAST SYBR master mix (Bioline BIO-98050) using primers for target genes and 18S rRNA or phosphoglycerate kinase (PGK ...
-
bioRxiv - Cancer Biology 2022Quote: PCR reactions were performed in 25 μl reactions using the MyTaq Red Mix (Bioline, Meridian Life Science). The RT-PCR reaction conditions were optimised for each primer pair and are designated as Condition A to D ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 12.5 µl of 2X BioMix PCR master mix (Bioline, UK), 0.75 µl of 0.3 µM forward and reverse primer (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantitative PCR with the library quantification kit from Bioline Jet Set Library Quantification Kit LoROX (Meridian Bioscience ...
-
bioRxiv - Neuroscience 2022Quote: ... using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation, Alvinston, ON, Canada). Complementary DNA of mRNA was amplified using a pair of specific forward and reverse primers (Supplementary Table 2) ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Physiology 2022Quote: ... and quantitative PCR was performed using SensiFAST SYBR reagent (Bioline, #BIO-98020). Transcript abundance was normalized using Ywhae as a reference gene ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR assays were performed using PyroTaq EvaGreen mix Plus (ROX) (CulteK Molecular Bioline, Spain) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The tagmented DNA was added to a PCR reaction with 2x MyTaq mix (BIO-25041; Bioline) with primers that add library specific indexes and amplified for 10 cycles ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl BIO-X-ACT short DNA polymerase (Bioline Reagents Ltd, London, UK), 35.4 μl ddH2O ...
-
bioRxiv - Pathology 2022Quote: ... falciparum infection was detected using a rapid malaria antigen test (SD-Bioline Malaria AG Pf/PAN, Abbott, # 05FK60) and confirmed microscopically in Giemsa-stained thick blood smears ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1U of BioTaq polymerase (Bioline), 0.2 mM dNTPs ...