Citations for Bioline :
1 - 50 of 1343
citations
since 2017
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were purified with the BIOLINE ISOLATE II Plasmid Mini Kit (#BIO-52057; Bioline). Before addition to the one-pot restriction-ligation reaction ...
-
bioRxiv - Microbiology 2022Quote: ... 12.5 μl of MyTaq Red Mix (Bioline) and 0.5 μl of 10 μM of each primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified RNA (500 ng) was transcribed into cDNA with Tetro cDNA Synthesis Kit (Bioline Reagents Limited, London, UK) to analyze genes expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time quantitative PCR (RT-qPCR) reactions were performed (Bioline #BIO-98020). NCBI primer BLAST software was used for oligonucleotide design (Ye et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized with the SensiFAST cDNA Synthesis Kit (Bioline; Cat. No. 65054). Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline; Cat. No. BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline). Quantitative PCR was performed according to the manufacturer’s instructions (Bioline) ...
-
bioRxiv - Microbiology 2022Quote: ... 1.5 μl of sterile water and 7.5 μl SYBR Hi-ROX mix (Bioline). Reaction conditions were as follows ...
-
bioRxiv - Molecular Biology 2022Quote: Cells or frozen tissue samples were homogenised and lysed in TRIsure (Bioline). Total RNA was isolated using EconoSpin All-In-One Mini Spin Columns (EconoSpin 1920-250 ...
-
bioRxiv - Developmental Biology 2022Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... One microlitre of Chelex extracted DNA was amplified with the appropriate primers and MyTaq polymerase (Bioline) in a 20 μl volume ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the SensiFAST SYBR No-ROX kit (Bioline) according to the manufacturer’s protocol and the LightCycler480 Instrument II (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054) or the iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... qPCR reactions comprised 1X SYBR Green No-Rox (Bioline), 250 nM forward and reverse primers (Supplementary Table 1) ...
-
bioRxiv - Genetics 2022Quote: ... 1X SYBR Green (Bioline), 250 nM primers up to a final volume of 10 μL were cycled using a ViiA7 real-time thermocycler and QuantStudio V1.3 (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... the SensiFAST SYBR No-ROX Kit (Bioline, BIO-98005) was used with primers for Plp1 (Forward ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from samples using the ISOLATE II RNA Micro Kit (Bioline, BIO-52075) or the ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and TaqMan probes for Gapdh (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... The purified DNAs were amplified with SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) by real-time qPCR.
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined with a quantitative real time PCR SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) on a Light Cycler® 480 Instrument II (Roche Life Sciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli α-select chemically competent cells (Bioline BIO-85026) and colonies were selected on YT glucose plus 50 mg/mL spectinomycin HCl (Sigma-Aldrich S9007) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were separated by gel electrophoresis on 2% DNA grade agarose (Bioline) in TAE buffer(40 mM Tris Acetate ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Cell Biology 2022Quote: ... and maintained with Ribosafe RNAse Inhibitor (Bioline). Quality and quantity of RNA were assessed by Nanodrop (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: RNA was isolated from lung and blood using Isolate II RNA mini kit protocol (Bioline Reagents Ltd., London, UK) with slight modification ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using 2 µg of RNA and the Tetro cDNA synthesis kit (Bioline Reagents Ltd., London, UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR assays were performed using PyroTaq EvaGreen mix Plus (ROX) (CulteK Molecular Bioline, Spain) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was conducted using BIOTAQ DNA polymerase (Bioline, USA). PCR conditions consisted of an initial denaturation step at 94°C for 1 min and 30 cycles of amplification ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The tagmented DNA was added to a PCR reaction with 2x MyTaq mix (BIO-25041; Bioline) with primers that add library specific indexes and amplified for 10 cycles ...
-
bioRxiv - Zoology 2022Quote: We set up 50 μl PCR reactions using 2.5 μl template DNA and 47.5 μl PCR mastermix made from 5 μl of 10× OptiBuffer (Bioline Reagents Ltd, UK), 2.5 μl of primer at 10 μM ...
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl BIO-X-ACT short DNA polymerase (Bioline Reagents Ltd, London, UK), 35.4 μl ddH2O ...
-
bioRxiv - Pathology 2022Quote: ... falciparum infection was detected using a rapid malaria antigen test (SD-Bioline Malaria AG Pf/PAN, Abbott, # 05FK60) and confirmed microscopically in Giemsa-stained thick blood smears ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1U of BioTaq polymerase (Bioline), 0.2 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... utilizing the SensiMix™ SYBR® Hi-ROX Kit (Bioline, Meridian Bioscience; Cincinnati, OH), as previously described (primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR reactions were carried out using 1.25 ng total RNA equivalent RT reaction in sensiFAST SYBR No-Rox mix (Bioline) in presence of 600 nM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
bioRxiv - Microbiology 2022Quote: ... A few microliters of each PCR product were run on an agarose gel to assess the success of the PCR reaction and the remains cleaned through an Isolate II PCR and Gel kit (Bioline, USA) and sent for sequencing with primer C1-N-2191 ...
-
bioRxiv - Genomics 2022Quote: PCRs were performed using MyTaq HS DNA Polymerase (Bioline, Cat#: BIO-21111). Reaction mixes contained 5μL 5× MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were run on 0.8-2% agarose gels (Bioline, Cat#: BIO-41025), depending on fragment size ...
-
bioRxiv - Genomics 2022Quote: ... TE-genome junction validation PCRs were performed using MyTaq HS DNA Polymerase (Bioline, Cat#: BIO-2111). Reaction mixes contained 5μL 5× MyTaq Reaction Buffer ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and IMMOLASETM DNA polymerase (5 U/μl) (Bioline; Cat. No. BIO-21047) as described by Lee et al ...